dme_circ_0001871	circRNA	drosophila melanogaster	Laccase2		dme_circ_0001871				26450910	Combinatorial control of Drosophila circular RNA expression by intronic repeats, hnRNPs, and SR proteins.	Kramer MC, Liang D, Tatomer DC, Gold B, March ZM, Cherry S, Wilusz JE.	Genes Dev.  2015	A 490-nt transcript derived from the laccase2 gene were detected in S2 and DL1 cells. Notably, unlike the PlexA locus, the 490-nt Laccase2 transcript was more abundant (approximately fivefold and  2.5-fold in DL1 and S2 cells, respectively) than the linear Laccase2 mRNA, which encodes an enzyme implicated in cuticle formation and pigmentation.	northern blots	S2 and DL1 cells												
circMbl3	circRNA	drosophila melanogaster	Mbl		dme_circ_0002508				28344080	Translation of CircRNAs.	Pamudurti NR, Bartok O, Jens M, Ashwal-Fluss R, Stottmeister C, Ruhe L, Hanan M, Wyler E, Perez-Hernandez D, Ramberger E, Shenzis S, Samson M, Dittmar G, Landthaler M, Chekulaeva M, Rajewsky N, Kadener S.	Mol Cell.  2017	We found that a circRNA generated from the muscleblind locus encodes a protein, which we detected in fly head extracts by mass spectrometry. Next, by performing in vivo and in vitro translation assays, we show that UTRs of ribo-circRNAs (cUTRs) allow cap-independent translation. Moreover, we found that starvation and FOXO likely regulate the translation of a circMbl isoform.	mass spectrometry	fly heads, S2 cells												
tric31905	circRNA	drosophila melanogaster	CR31905				AGTTTCCGAGGCTTGGTGATGCGAGCAGAGGCAGGACTCTGGGCCAAACAATACCATGGCCCCAGATAGCGCTTGCTCTTGTTTCATCAGTTAGTGAATCGCGATATGTTGAA		26194134	Metazoan tRNA introns generate stable circular RNAs in vivo.	Lu Z, Filonov GS, Noto JJ, Schmidt CA, Hatkevich TL, Wen Y, Jaffrey SR, Matera AG.	RNA.  2015	Collectively, these experiments demonstrate that splicing of the CR31905 transcript generates a stable intronic RNA, termed tric31905, and that the predominant form of this molecule is circular. We examined expression of tric31905 over developmental time and found that its levels increase substantially from embryos to adults. In contrast, expression of the mature tRNA (TyrGUA) was relatively constant. Notably, tric31905 expression was slightly lower in adult females, perhaps because the ovary is such a large organ and expression levels in these tissues were relatively low. Consistent with their embryonic origin, Schneider2 cells also showed relatively low levels.	qRT-PCR, northern blots	fly larvae, pupae and adults