mmu_circRNA_19423	circRNA	rattus norvegicus			mmu_circRNA_19423 mouse orthology sequence			induced acute respiratory distress syndrome	28864418	The expression profiles of circRNAs in lung tissues from rats with lipopolysaccharide-induced acute respiratory distress syndrome: A microarray study.	Wan QQ, Wu D, Ye QF.	Biochem Biophys Res Commun.  2017	Up-regulated in LPS group versus control group, which were consistent with the microarray results	microarray, qRT-PCR	lipopolysaccharide-induced acute respiratory distress syndrome model in rats						rno-miR-708-5p, rno-miR-665, rno-miR-28-5p, rno-miR-485-5p, rno-miR-31a-3p	circRNA-miRNA		predicted			
mmu_circRNA_30664	circRNA	rattus norvegicus			mmu_circRNA_30664 mouse orthology sequence			induced acute respiratory distress syndrome	28864418	The expression profiles of circRNAs in lung tissues from rats with lipopolysaccharide-induced acute respiratory distress syndrome: A microarray study.	Wan QQ, Wu D, Ye QF.	Biochem Biophys Res Commun.  2017	Up-regulated in LPS group versus control group, which were consistent with the microarray results	microarray, qRT-PCR	lipopolysaccharide-induced acute respiratory distress syndrome model in rats						rno-miR-107-5p, rno-miR-214-3p, rno-miR-665, rno-miR-103-1-5p, rno-miR-3557-3p	circRNA-miRNA		predicted			
rno_circRNA_010489	circRNA	rattus norvegicus						induced acute respiratory distress syndrome	28864418	The expression profiles of circRNAs in lung tissues from rats with lipopolysaccharide-induced acute respiratory distress syndrome: A microarray study.	Wan QQ, Wu D, Ye QF.	Biochem Biophys Res Commun.  2017	Up-regulated in LPS group versus control group, which were consistent with the microarray results	microarray, qRT-PCR	lipopolysaccharide-induced acute respiratory distress syndrome model in rats						rno-miR-466b-5p, rno-miR-328a-5p, rno-miR-665, rno-miR-361-3p, rno-miR-34c-5p	circRNA-miRNA		predicted			
rno_circRNA_005564	circRNA	rattus norvegicus						induced acute respiratory distress syndrome	28864418	The expression profiles of circRNAs in lung tissues from rats with lipopolysaccharide-induced acute respiratory distress syndrome: A microarray study.	Wan QQ, Wu D, Ye QF.	Biochem Biophys Res Commun.  2017	Down-regulated in LPS group versus control group, which were consistent with the microarray results	microarray, qRT-PCR	lipopolysaccharide-induced acute respiratory distress syndrome model in rats						rno-miR-673-5p, rno-miR-219b, rno-miR-185-3p, rno-miR-5132-3p, rno-miR-146a-3p	circRNA-miRNA		predicted			
rno_circRNA_011426	circRNA	rattus norvegicus						induced acute respiratory distress syndrome	28864418	The expression profiles of circRNAs in lung tissues from rats with lipopolysaccharide-induced acute respiratory distress syndrome: A microarray study.	Wan QQ, Wu D, Ye QF.	Biochem Biophys Res Commun.  2017	Up-regulated in LPS group versus control group, which were consistent with the microarray results	microarray, qRT-PCR	lipopolysaccharide-induced acute respiratory distress syndrome model in rats						rno-miR-874-3p, rno-miR-127-5p, rno-miR-101a-5p, rno-miR-148a-5p, rno-miR-3558-3p	circRNA-miRNA		predicted			
2:27713879|27755789	circRNA	rattus norvegicus						osteogenesis	28919414	Changes in related circular RNAs following ERβ knockdown and the relationship to rBMSC osteogenesis.	Li X, Peng B, Zhu X, Wang P, Xiong Y, Liu H, Sun K, Wang H, Ou L, Wu Z, Liu X, He H, Mo S, Peng X, Tian Y, Zhang R, Yang L.	Biochem Biophys Res Commun.  2017	down-regulated in samples from the ERb knockdown groups compared to controls.	qRT-PCR	rat bone marrow-derived mesenchymal stem cells						miR-328-5p	circRNA-miRNA		predicted	miR-328-5p could be targeted by both 2:27713879j27755789 and 2:240822115j240867796 in the network, suggesting it might play a crucial role in osteogenesis.		
rno_circRNA_006016	circRNA	rattus norvegicus						Cardiovascular and Renal Diseases	28778982	Circular RNAs in rat models of cardiovascular and renal diseases.	Cheng X, Joe B.	Physiol Genomics.  2017	This differentially expressed circRNA shown in the microarray analysis was further validated by qRT-PCR and qRT-PCR amplified circRNA products were further confirmed using gel electrophoresis.	microarray, qRT-PCR	the Dahl salt-sensitive rat (S), the Dahl salt-resistant rat (R)						rno-miR-297, rno-miR-466b-5p, rno-miR-423-5p, rno-miR-3573-5p and rno-miR-185-5p	circRNA-miRNA		predicted	The top 5 predicted miRNA targets of rno_circRNA_006016 were rno-miR-297, rno-miR-466b-5p, rno-miR-423-5p, rno-miR-3573-5p and rno-miR-185-5p.		
2:240822115|240867796	circRNA	rattus norvegicus						osteogenesis	28919414	Changes in related circular RNAs following ERβ knockdown and the relationship to rBMSC osteogenesis.	Li X, Peng B, Zhu X, Wang P, Xiong Y, Liu H, Sun K, Wang H, Ou L, Wu Z, Liu X, He H, Mo S, Peng X, Tian Y, Zhang R, Yang L.	Biochem Biophys Res Commun.  2017	up-regulated in samples from the ERb knockdown groups compared to controls.	qRT-PCR							miR-328-5p	circRNA-miRNA		predicted	miR-328-5p could be targeted by both 2:27713879j27755789 and 2:240822115j240867796 in the network, suggesting it might play a crucial role in osteogenesis.		
circ-Phf21a	circRNA	rattus norvegicus	Phf21a					cardiovascular diseases	28676412	Identification of circular RNAs with host gene-independent expression in human model systems for cardiac differentiation and disease.	Siede D, Rapti K, Gorska AA, Katus HA, Altmüller J, Boeckel JN, Meder B, Maack C, Völkers M, Müller OJ, Backs J, Dieterich C.	J Mol Cell Cardiol.  2017									Argonaute 2 protein	circRNA-protein	cardiac myocytes from rat	RIP	Two circles (Slc8a1 and Phf21a) show an enrichment of BSJ reads (column 1-4, Figure 4D) in Argonaute 2 RIP experiments over linear spliced reads (column 5-8) and high-levels of Ago2 association (column 1,2) in comparison to the cytosolic fraction (column 3,4).		
circ-Slc8a1	circRNA	rattus norvegicus	Slc8a1					cardiovascular diseases	28676412	Identification of circular RNAs with host gene-independent expression in human model systems for cardiac differentiation and disease.	Siede D, Rapti K, Gorska AA, Katus HA, Altmüller J, Boeckel JN, Meder B, Maack C, Völkers M, Müller OJ, Backs J, Dieterich C.	J Mol Cell Cardiol.  2017									Argonaute 2 protein	circRNA-protein	cardiac myocytes from rat	RIP	Two circles (Slc8a1 and Phf21a) show an enrichment of BSJ reads (column 1-4, Figure 4D) in Argonaute 2 RIP experiments over linear spliced reads (column 5-8) and high-levels of Ago2 association (column 1,2) in comparison to the cytosolic fraction (column 3,4).		
chr1: 164931730¡¬164947123	circRNA	rattus norvegicus						acute lung injury	29188496	The differential expression of novel circular RNAs in an acute lung injury rat model caused by smoke inhalation.	Ye Z, Liu X, Yang Y, Zhang X, Yu T, Li S, Feng Y, Luo G.	J Physiol Biochem.  2018	The quantitative PCR combined with RNase digestion also supported the conclusion that the circRNA identified by our next-generation sequencing assay were truly in the circular loop form.	RNA-seq, qRT-PCR	bronchoalveolar lavage fluid and lung tissue of acute lung injury rat model												
chr19:49158646¡¬49159228	circRNA	rattus norvegicus						acute lung injury	29188496	The differential expression of novel circular RNAs in an acute lung injury rat model caused by smoke inhalation.	Ye Z, Liu X, Yang Y, Zhang X, Yu T, Li S, Feng Y, Luo G.	J Physiol Biochem.  2018	The quantitative PCR combined with RNase digestion also supported the conclusion that the circRNA identified by our next-generation sequencing assay were truly in the circular loop form.	RNA-seq, qRT-PCR	bronchoalveolar lavage fluid and lung tissue of acute lung injury rat model												
chr6: 72537858¡¬72538290	circRNA	rattus norvegicus						acute lung injury	29188496	The differential expression of novel circular RNAs in an acute lung injury rat model caused by smoke inhalation.	Ye Z, Liu X, Yang Y, Zhang X, Yu T, Li S, Feng Y, Luo G.	J Physiol Biochem.  2018	The quantitative PCR combined with RNase digestion also supported the conclusion that the circRNA identified by our next-generation sequencing assay were truly in the circular loop form.	RNA-seq, qRT-PCR	bronchoalveolar lavage fluid and lung tissue of acute lung injury rat model												
chr9:73798311¡¬73799430	circRNA	rattus norvegicus						acute lung injury	29188496	The differential expression of novel circular RNAs in an acute lung injury rat model caused by smoke inhalation.	Ye Z, Liu X, Yang Y, Zhang X, Yu T, Li S, Feng Y, Luo G.	J Physiol Biochem.  2018	The quantitative PCR combined with RNase digestion also supported the conclusion that the circRNA identified by our next-generation sequencing assay were truly in the circular loop form.	RNA-seq, qRT-PCR	bronchoalveolar lavage fluid and lung tissue of acute lung injury rat model												
9:20596863|20599410	circRNA	rattus norvegicus						osteogenesis	28919414	Changes in related circular RNAs following ERβ knockdown and the relationship to rBMSC osteogenesis.	Li X, Peng B, Zhu X, Wang P, Xiong Y, Liu H, Sun K, Wang H, Ou L, Wu Z, Liu X, He H, Mo S, Peng X, Tian Y, Zhang R, Yang L.	Biochem Biophys Res Commun.  2017	up-regulated in samples from the ERb knockdown groups compared to controls.	RNA-seq, qRT-PCR	control and ERb-deficient rat bone marrow-derived mesenchymal stem cells												
rno_circRNA_007419	circRNA	rattus norvegicus						Chronic constriction injury of sciatic nerve	28761373	Chronic constriction injury of sciatic nerve changes circular RNA expression in rat spinal dorsal horn.	Cao S, Deng W, Li Y, Qin B, Zhang L, Yu S, Xie P, Xiao Z, Yu T.	J Pain Res.  2017	down-regulated in ipsilateral dorsal horn samples of CCI rat model	microarray, qRT-PCR	Ipsilateral dorsal horn samples of CCI rat model, controls												
rno_circRNA_007512	circRNA	rattus norvegicus						Chronic constriction injury of sciatic nerve	28761373	Chronic constriction injury of sciatic nerve changes circular RNA expression in rat spinal dorsal horn.	Cao S, Deng W, Li Y, Qin B, Zhang L, Yu S, Xie P, Xiao Z, Yu T.	J Pain Res.  2017	down-regulated in ipsilateral dorsal horn samples of CCI rat model	microarray, qRT-PCR	Ipsilateral dorsal horn samples of CCI rat model, controls												
rno_circRNA_010913	circRNA	rattus norvegicus						Chronic constriction injury of sciatic nerve	28761373	Chronic constriction injury of sciatic nerve changes circular RNA expression in rat spinal dorsal horn.	Cao S, Deng W, Li Y, Qin B, Zhang L, Yu S, Xie P, Xiao Z, Yu T.	J Pain Res.  2017	down-regulated in ipsilateral dorsal horn samples of CCI rat model	microarray, qRT-PCR	Ipsilateral dorsal horn samples of CCI rat model, controls												
rno_circRNA_011111	circRNA	rattus norvegicus						Chronic constriction injury of sciatic nerve	28761373	Chronic constriction injury of sciatic nerve changes circular RNA expression in rat spinal dorsal horn.	Cao S, Deng W, Li Y, Qin B, Zhang L, Yu S, Xie P, Xiao Z, Yu T.	J Pain Res.  2017	down-regulated in ipsilateral dorsal horn samples of CCI rat model	microarray, qRT-PCR	Ipsilateral dorsal horn samples of CCI rat model, controls												
rno_circRNA_008646	circRNA	rattus norvegicus						Chronic constriction injury of sciatic nerve	28761373	Chronic constriction injury of sciatic nerve changes circular RNA expression in rat spinal dorsal horn.	Cao S, Deng W, Li Y, Qin B, Zhang L, Yu S, Xie P, Xiao Z, Yu T.	J Pain Res.  2017	up-regulated in ipsilateral dorsal horn samples of CCI rat model	microarray, qRT-PCR	Ipsilateral dorsal horn samples of CCI rat model, controls												
rno_circRNA_008973	circRNA	rattus norvegicus						Chronic constriction injury of sciatic nerve	28761373	Chronic constriction injury of sciatic nerve changes circular RNA expression in rat spinal dorsal horn.	Cao S, Deng W, Li Y, Qin B, Zhang L, Yu S, Xie P, Xiao Z, Yu T.	J Pain Res.  2017	up-regulated in ipsilateral dorsal horn samples of CCI rat model	microarray, qRT-PCR	Ipsilateral dorsal horn samples of CCI rat model, controls												
rno_circRNA_013779	circRNA	rattus norvegicus						Chronic constriction injury of sciatic nerve	28761373	Chronic constriction injury of sciatic nerve changes circular RNA expression in rat spinal dorsal horn.	Cao S, Deng W, Li Y, Qin B, Zhang L, Yu S, Xie P, Xiao Z, Yu T.	J Pain Res.  2017	up-regulated in ipsilateral dorsal horn samples of CCI rat model	microarray, qRT-PCR	Ipsilateral dorsal horn samples of CCI rat model, controls												
rno_circRNA_35215	circRNA	rattus norvegicus						Chronic constriction injury of sciatic nerve	28761373	Chronic constriction injury of sciatic nerve changes circular RNA expression in rat spinal dorsal horn.	Cao S, Deng W, Li Y, Qin B, Zhang L, Yu S, Xie P, Xiao Z, Yu T.	J Pain Res.  2017	up-regulated in ipsilateral dorsal horn samples of CCI rat model	microarray, qRT-PCR	Ipsilateral dorsal horn samples of CCI rat model, controls												
circRNA_10008	circRNA	rattus norvegicus						mammary gland	26472973	Expression Patterns of Circular RNAs from Primary Kinase Transcripts in the Mammary Glands of Lactating Rats.	Zhang C, Wu H, Wang Y, Zhao Y, Fang X, Chen C, Chen H.	J Breast Cancer.  2015	RNase R resistance of all 11 novel backsplice events was apparent following RNase R treatment, whereas the abundance of linear RNAs was found to decrease. Moreover, oligo-dT priming for reverse transcription resulted in significantly lower levels of backspliced products relative to poly(A)-containing transcript levels, indicating that these species were not polyadenylated. The difference in the expression of the 11 circRNAs between the two time points was also confirmed by qPCR.	RNA-seq, qRT-PCR	Mammary Glands of Lactating Rats												
circRNA_127	circRNA	rattus norvegicus						mammary gland	26472973	Expression Patterns of Circular RNAs from Primary Kinase Transcripts in the Mammary Glands of Lactating Rats.	Zhang C, Wu H, Wang Y, Zhao Y, Fang X, Chen C, Chen H.	J Breast Cancer.  2015	RNase R resistance of all 11 novel backsplice events was apparent following RNase R treatment, whereas the abundance of linear RNAs was found to decrease. Moreover, oligo-dT priming for reverse transcription resulted in significantly lower levels of backspliced products relative to poly(A)-containing transcript levels, indicating that these species were not polyadenylated. The difference in the expression of the 11 circRNAs between the two time points was also confirmed by qPCR.	RNA-seq, qRT-PCR	Mammary Glands of Lactating Rats												
circRNA_15703	circRNA	rattus norvegicus						mammary gland	26472973	Expression Patterns of Circular RNAs from Primary Kinase Transcripts in the Mammary Glands of Lactating Rats.	Zhang C, Wu H, Wang Y, Zhao Y, Fang X, Chen C, Chen H.	J Breast Cancer.  2015	RNase R resistance of all 11 novel backsplice events was apparent following RNase R treatment, whereas the abundance of linear RNAs was found to decrease. Moreover, oligo-dT priming for reverse transcription resulted in significantly lower levels of backspliced products relative to poly(A)-containing transcript levels, indicating that these species were not polyadenylated. The difference in the expression of the 11 circRNAs between the two time points was also confirmed by qPCR.	RNA-seq, qRT-PCR	Mammary Glands of Lactating Rats												
circRNA_3385	circRNA	rattus norvegicus						mammary gland	26472973	Expression Patterns of Circular RNAs from Primary Kinase Transcripts in the Mammary Glands of Lactating Rats.	Zhang C, Wu H, Wang Y, Zhao Y, Fang X, Chen C, Chen H.	J Breast Cancer.  2015	RNase R resistance of all 11 novel backsplice events was apparent following RNase R treatment, whereas the abundance of linear RNAs was found to decrease. Moreover, oligo-dT priming for reverse transcription resulted in significantly lower levels of backspliced products relative to poly(A)-containing transcript levels, indicating that these species were not polyadenylated. The difference in the expression of the 11 circRNAs between the two time points was also confirmed by qPCR.	RNA-seq, qRT-PCR	Mammary Glands of Lactating Rats												
circRNA_36159	circRNA	rattus norvegicus						mammary gland	26472973	Expression Patterns of Circular RNAs from Primary Kinase Transcripts in the Mammary Glands of Lactating Rats.	Zhang C, Wu H, Wang Y, Zhao Y, Fang X, Chen C, Chen H.	J Breast Cancer.  2015	RNase R resistance of all 11 novel backsplice events was apparent following RNase R treatment, whereas the abundance of linear RNAs was found to decrease. Moreover, oligo-dT priming for reverse transcription resulted in significantly lower levels of backspliced products relative to poly(A)-containing transcript levels, indicating that these species were not polyadenylated. The difference in the expression of the 11 circRNAs between the two time points was also confirmed by qPCR.	RNA-seq, qRT-PCR	Mammary Glands of Lactating Rats												
circRNA_388	circRNA	rattus norvegicus						mammary gland	26472973	Expression Patterns of Circular RNAs from Primary Kinase Transcripts in the Mammary Glands of Lactating Rats.	Zhang C, Wu H, Wang Y, Zhao Y, Fang X, Chen C, Chen H.	J Breast Cancer.  2015	RNase R resistance of all 11 novel backsplice events was apparent following RNase R treatment, whereas the abundance of linear RNAs was found to decrease. Moreover, oligo-dT priming for reverse transcription resulted in significantly lower levels of backspliced products relative to poly(A)-containing transcript levels, indicating that these species were not polyadenylated. The difference in the expression of the 11 circRNAs between the two time points was also confirmed by qPCR.	RNA-seq, qRT-PCR	Mammary Glands of Lactating Rats												
circRNA_4815	circRNA	rattus norvegicus						mammary gland	26472973	Expression Patterns of Circular RNAs from Primary Kinase Transcripts in the Mammary Glands of Lactating Rats.	Zhang C, Wu H, Wang Y, Zhao Y, Fang X, Chen C, Chen H.	J Breast Cancer.  2015	RNase R resistance of all 11 novel backsplice events was apparent following RNase R treatment, whereas the abundance of linear RNAs was found to decrease. Moreover, oligo-dT priming for reverse transcription resulted in significantly lower levels of backspliced products relative to poly(A)-containing transcript levels, indicating that these species were not polyadenylated. The difference in the expression of the 11 circRNAs between the two time points was also confirmed by qPCR.	RNA-seq, qRT-PCR	Mammary Glands of Lactating Rats												
circRNA_537	circRNA	rattus norvegicus						mammary gland	26472973	Expression Patterns of Circular RNAs from Primary Kinase Transcripts in the Mammary Glands of Lactating Rats.	Zhang C, Wu H, Wang Y, Zhao Y, Fang X, Chen C, Chen H.	J Breast Cancer.  2015	RNase R resistance of all 11 novel backsplice events was apparent following RNase R treatment, whereas the abundance of linear RNAs was found to decrease. Moreover, oligo-dT priming for reverse transcription resulted in significantly lower levels of backspliced products relative to poly(A)-containing transcript levels, indicating that these species were not polyadenylated. The difference in the expression of the 11 circRNAs between the two time points was also confirmed by qPCR.	RNA-seq, qRT-PCR	Mammary Glands of Lactating Rats												
circRNA_555	circRNA	rattus norvegicus						mammary gland	26472973	Expression Patterns of Circular RNAs from Primary Kinase Transcripts in the Mammary Glands of Lactating Rats.	Zhang C, Wu H, Wang Y, Zhao Y, Fang X, Chen C, Chen H.	J Breast Cancer.  2015	RNase R resistance of all 11 novel backsplice events was apparent following RNase R treatment, whereas the abundance of linear RNAs was found to decrease. Moreover, oligo-dT priming for reverse transcription resulted in significantly lower levels of backspliced products relative to poly(A)-containing transcript levels, indicating that these species were not polyadenylated. The difference in the expression of the 11 circRNAs between the two time points was also confirmed by qPCR.	RNA-seq, qRT-PCR	Mammary Glands of Lactating Rats												
circRNA_659	circRNA	rattus norvegicus						mammary gland	26472973	Expression Patterns of Circular RNAs from Primary Kinase Transcripts in the Mammary Glands of Lactating Rats.	Zhang C, Wu H, Wang Y, Zhao Y, Fang X, Chen C, Chen H.	J Breast Cancer.  2015	RNase R resistance of all 11 novel backsplice events was apparent following RNase R treatment, whereas the abundance of linear RNAs was found to decrease. Moreover, oligo-dT priming for reverse transcription resulted in significantly lower levels of backspliced products relative to poly(A)-containing transcript levels, indicating that these species were not polyadenylated. The difference in the expression of the 11 circRNAs between the two time points was also confirmed by qPCR.	RNA-seq, qRT-PCR	Mammary Glands of Lactating Rats												
circRNA_7070	circRNA	rattus norvegicus						mammary gland	26472973	Expression Patterns of Circular RNAs from Primary Kinase Transcripts in the Mammary Glands of Lactating Rats.	Zhang C, Wu H, Wang Y, Zhao Y, Fang X, Chen C, Chen H.	J Breast Cancer.  2015	RNase R resistance of all 11 novel backsplice events was apparent following RNase R treatment, whereas the abundance of linear RNAs was found to decrease. Moreover, oligo-dT priming for reverse transcription resulted in significantly lower levels of backspliced products relative to poly(A)-containing transcript levels, indicating that these species were not polyadenylated. The difference in the expression of the 11 circRNAs between the two time points was also confirmed by qPCR.	RNA-seq, qRT-PCR	Mammary Glands of Lactating Rats												
circ137	circRNA	rattus norvegicus						liver regeneration	28086788	Comprehensive CircRNA expression profile and selection of key CircRNAs during priming phase of rat liver regeneration.	Li L, Guo J, Chen Y, Chang C, Xu C.	BMC Genomics.  2017	Down-regulated during priming phase of rat LR, which had accordance with the high-throughput sequencing result.	RNA-seq, qRT-PCR	priming phase of rat liver regeneration												
circ2270	circRNA	rattus norvegicus						liver regeneration	28086788	Comprehensive CircRNA expression profile and selection of key CircRNAs during priming phase of rat liver regeneration.	Li L, Guo J, Chen Y, Chang C, Xu C.	BMC Genomics.  2017	Down-regulated during priming phase of rat LR, which had accordance with the high-throughput sequencing result.	RNA-seq, qRT-PCR	priming phase of rat liver regeneration												
circ1366	circRNA	rattus norvegicus	TNFRSF21					liver regeneration	28086788	Comprehensive CircRNA expression profile and selection of key CircRNAs during priming phase of rat liver regeneration.	Li L, Guo J, Chen Y, Chang C, Xu C.	BMC Genomics.  2017	Up-regulated during priming phase of rat LR, which had accordance with the high-throughput sequencing result.	RNA-seq, qRT-PCR	priming phase of rat liver regeneration												
circ15	circRNA	rattus norvegicus	GOT1					liver regeneration	28086788	Comprehensive CircRNA expression profile and selection of key CircRNAs during priming phase of rat liver regeneration.	Li L, Guo J, Chen Y, Chang C, Xu C.	BMC Genomics.  2017	Up-regulated during priming phase of rat LR, which had accordance with the high-throughput sequencing result.	RNA-seq, qRT-PCR	priming phase of rat liver regeneration												
circ2077	circRNA	rattus norvegicus	FN1					liver regeneration	28086788	Comprehensive CircRNA expression profile and selection of key CircRNAs during priming phase of rat liver regeneration.	Li L, Guo J, Chen Y, Chang C, Xu C.	BMC Genomics.  2017	Up-regulated during priming phase of rat LR, which had accordance with the high-throughput sequencing result.	RNA-seq, qRT-PCR	priming phase of rat liver regeneration												
circ432	circRNA	rattus norvegicus	MAPK14					liver regeneration	28086788	Comprehensive CircRNA expression profile and selection of key CircRNAs during priming phase of rat liver regeneration.	Li L, Guo J, Chen Y, Chang C, Xu C.	BMC Genomics.  2017	Up-regulated during priming phase of rat LR, which had accordance with the high-throughput sequencing result.	RNA-seq, qRT-PCR	priming phase of rat liver regeneration												
10:71546978|71557193	circRNA	rattus norvegicus						osteogenesis	28919414	Changes in related circular RNAs following ERβ knockdown and the relationship to rBMSC osteogenesis.	Li X, Peng B, Zhu X, Wang P, Xiong Y, Liu H, Sun K, Wang H, Ou L, Wu Z, Liu X, He H, Mo S, Peng X, Tian Y, Zhang R, Yang L.	Biochem Biophys Res Commun.  2017	down-regulated in samples from the ERb knockdown groups compared to controls.	qRT-PCR	rat bone marrow-derived mesenchymal stem cells												
15:103872241|103886205	circRNA	rattus norvegicus						osteogenesis	28919414	Changes in related circular RNAs following ERβ knockdown and the relationship to rBMSC osteogenesis.	Li X, Peng B, Zhu X, Wang P, Xiong Y, Liu H, Sun K, Wang H, Ou L, Wu Z, Liu X, He H, Mo S, Peng X, Tian Y, Zhang R, Yang L.	Biochem Biophys Res Commun.  2017	down-regulated in samples from the ERb knockdown groups compared to controls.	qRT-PCR	rat bone marrow-derived mesenchymal stem cells												
16:23555919|23600154	circRNA	rattus norvegicus						osteogenesis	28919414	Changes in related circular RNAs following ERβ knockdown and the relationship to rBMSC osteogenesis.	Li X, Peng B, Zhu X, Wang P, Xiong Y, Liu H, Sun K, Wang H, Ou L, Wu Z, Liu X, He H, Mo S, Peng X, Tian Y, Zhang R, Yang L.	Biochem Biophys Res Commun.  2017	down-regulated in samples from the ERb knockdown groups compared to controls.	qRT-PCR	rat bone marrow-derived mesenchymal stem cells												
2:23399715|23410608	circRNA	rattus norvegicus						osteogenesis	28919414	Changes in related circular RNAs following ERβ knockdown and the relationship to rBMSC osteogenesis.	Li X, Peng B, Zhu X, Wang P, Xiong Y, Liu H, Sun K, Wang H, Ou L, Wu Z, Liu X, He H, Mo S, Peng X, Tian Y, Zhang R, Yang L.	Biochem Biophys Res Commun.  2017	down-regulated in samples from the ERb knockdown groups compared to controls.	qRT-PCR	rat bone marrow-derived mesenchymal stem cells												
circSgms2_2¨C3	circRNA	rattus norvegicus	Sgms2		KU840805		TATCCAACGGGCTACGAAAGGGTGCCAAGAAATACCCGGACTACATCCAGATTTCCATGCCCAATGACTCCAGGAACAAGCTTCCCCTAGAGTGGTGGAAAACAGGCATTGCCTTTGTGTACGCTCTCTTCAACCTTATCCTGACAACAGTCATGATCACCGTTGTGCACGAGAGGGTCCCTCCCAAGGAACTCAGCCCTCCACTCCCAGACAAGTTTTTTGATTACGTCGACCGGGTCAAATGGGCATTTTCTGTATCAGAAATAAATGGGATGGTATTAGTTGGGCTATGGCTCACCCAGTGGCTCTTTCTGAGATACAAAAGGGACAATACCATCCTCTGTGGGAAGGAGAACCAGCTTCCTTGTGGTGACTACACAGCAGACCAGAAGGCCACCGTCTACGATTCATATCAGCACACACAGTCTATCCTAAGAGTCCATGTTGATCTTGGAAGTAGAGAGGTTTAAAAGAAGTTCCCACAGAAACCAAGAGCCTTACCATCTCCTTTAGCTCCGAAGGCTGGCGGACAATGGATATCATAGAGACAGCAAAACTTGAAGGTCATTTGGAAAGTCAAACCAACAACTCTACCAACACTTACACAAGCCCCACTGAAGCTGTAGAAGAGGAGGACAAAAATGGCAAGGGTAAACCCAAGACCT	sphingomyelin synthase activity	29294205	Developmental stage-specific expression of genes for sphingomyelin synthase in rat brain.	Filippenkov IB, Kolomin TA, Limborska SA, Dergunova LV.	Cell Tissue Res.  2018	Using RT¨CPCR and Sanger sequencing of rat brain cDNA samples, we were able to detect two circRNAs: circSgms2_2 (665 nt) and circSgms2_2¨C3 (783 nt). The analysis of the revealed circRNAs circSgms2_2 and circSgms2_2¨C3 in the brain of rats was conducted by real-time PCR.	RT¨CPCR, sanger sequencing, qRT-PCR	rat brain												
circSgms2_2	circRNA	rattus norvegicus	Sgms2		KU840804		TATCCAACGGGCTACGAAAGGGTGCCAAGAAATACCCGGACTACATCCAGATTTCCATGCCCAATGACTCCAGGAACAAGCTTCCCCTAGAGTGGTGGAAAACAGGCATTGCCTTTGTGTACGCTCTCTTCAACCTTATCCTGACAACAGTCATGATCACCGTTGTGCACGAGAGGGTCCCTCCCAAGGAACTCAGCCCTCCACTCCCAGACAAGTTTTTTGATTACGTCGACCGGGTCAAATGGGCATTTTCTGTATCAGAAATAAATGGGATGGTATTAGTTGGGCTATGGCTCACCCAGTGGCTCTTTCTGAGATACAAGTCAATAGTGGGACGCAGATTCTTCTTTATCATGGGAACTTTATACCTGTATCGCTGTATAACTATGTACGTCACTACGTTACCTGTGCCCGGAATGCACTTCCAGTGTGCTCCAAAGAAGGGACAATACCATCCTCTGTGGGAAGGAGAACCAGCTTCCTTGTGGTGACTACACAGCAGACCAGAAGGCCACCGTCTACGATTCATATCAGCACACACAGTCTATCCTAAGAGTCCATGTTGATCTTGGAAGTAGAGAGGTTTAAAAGAAGTTCCCACAGAAACCAAGAGCCTTACCATCTCCTTTAGCTCCGAAGGCTGGCGGACAATGGATATCATAGAGACAGCAAAACTTGAAGGTCATTTGGAAAGTCAAACCAACAACTCTACCAACACTTACACAAGCCCCACTGAAGCTGTAGAAGAGGAGGACAAAAATGGCAAGGGTAAACCCAAGACCT	sphingomyelin synthase activity	29294205	Developmental stage-specific expression of genes for sphingomyelin synthase in rat brain.	Filippenkov IB, Kolomin TA, Limborska SA, Dergunova LV.	Cell Tissue Res.  2018	Using RT¨CPCR and Sanger sequencing of rat brain cDNA samples, we were able to detect two circRNAs: circSgms2_2 (665 nt) and circSgms2_2¨C3 (783 nt). The analysis of the revealed circRNAs circSgms2_2 and circSgms2_2¨C3 in the brain of rats was conducted by real-time PCR.	RT¨CPCR, sanger sequencing, qRT-PCR	rat brain												
circCyp2c24	circRNA	rattus norvegicus	Cyp2c24				TTCTCAAAAATTTATGGCCCTGTGTTCACTCTGTACTTTGGTCCGAAGCCTACTGTGGTGGTACATGGATATGAAGCAGTAAAGGAAGCCCTGGATGATCTTGGAGAGGAGTTTTCTGGGAGGGGTAGTTTCCCAATTGTTGAAAGAATGAATAATGGCCTTGGGGTCATTTTCAGCAATGGAACAAAATGGAAGGAGCTTCGGCATTTCTCACTTATGACCTTGAGAAATTTTGGGATGGGGAAGAGGAGCATCGAGGATCGCATTCAAGAGGAAGCCTCCTGTCTTGTGGAAGAGCTAAGAAAAACAAATGGCTCACTCTGTGATCCCACATTCATCCTGAGCTGTGCTCCCTCCAACGTGATCTGCTCAGTTGTTTTCCATAATCGTTTTGATTATAAAGATGAGAATTTCCTTAACTTGATGGAGAAACTCAATGAAAACTTTAAAATCTTGAACTCCCCATGGATGCAG		8692851	Circular RNAs from transcripts of the rat cytochrome P450 2C24 gene: correlation with exon skipping.	Zaphiropoulos PG.	Proc Natl Acad Sci U S A.  1996	Expressed in liver and kidney tissue	RT-PCR	rat liver and kidney tissue												
rno_circ_0005854	circRNA	rattus norvegicus						Neuropathic pain	28420964	Identification of the Spinal Expression Profile of Non-coding RNAs Involved in Neuropathic Pain Following Spared Nerve Injury by Sequence Analysis.	Zhou J, Xiong Q, Chen H, Yang C, Fan Y.	Front Mol Neurosci.  2017	Down-regulated in the SNI group compared with the CON group at 14 days after spared nerve injury.	RNA-seq, qRT-PCR	spinal cord following spared nerve injury-induced NP, controls												
rno_circ_0004058	circRNA	rattus norvegicus						Neuropathic pain	28420964	Identification of the Spinal Expression Profile of Non-coding RNAs Involved in Neuropathic Pain Following Spared Nerve Injury by Sequence Analysis.	Zhou J, Xiong Q, Chen H, Yang C, Fan Y.	Front Mol Neurosci.  2017	Up-regulated in the SNI group compared with the CON group at 14 days after spared nerve injury.	RNA-seq, qRT-PCR	spinal cord following spared nerve injury-induced NP, controls												
rno_circRNA_001167	circRNA	rattus norvegicus						Traumatic Brain Injury	29357736	Circular RNA Expression Profiles Alter Significantly After Traumatic Brain Injury in Rats.	Xie B, Wang Y, Lin Y, Zhao CC, Mao Q, Feng JF, Cao J, Gao GY, Jiang J.	J Neurotrauma.  2018	downregulated significantly after TBI	microarray, qRT-PCR	TBI rat model												
rno_circRNA_001168	circRNA	rattus norvegicus						Traumatic Brain Injury	29357736	Circular RNA Expression Profiles Alter Significantly After Traumatic Brain Injury in Rats.	Xie B, Wang Y, Lin Y, Zhao CC, Mao Q, Feng JF, Cao J, Gao GY, Jiang J.	J Neurotrauma.  2018	downregulated significantly after TBI	microarray, qRT-PCR	TBI rat model												
rno_circRNA_006508	circRNA	rattus norvegicus						Traumatic Brain Injury	29357736	Circular RNA Expression Profiles Alter Significantly After Traumatic Brain Injury in Rats.	Xie B, Wang Y, Lin Y, Zhao CC, Mao Q, Feng JF, Cao J, Gao GY, Jiang J.	J Neurotrauma.  2018	upregulated significantly after TBI	microarray, qRT-PCR	TBI rat model												
rno_circRNA_010705	circRNA	rattus norvegicus						Traumatic Brain Injury	29357736	Circular RNA Expression Profiles Alter Significantly After Traumatic Brain Injury in Rats.	Xie B, Wang Y, Lin Y, Zhao CC, Mao Q, Feng JF, Cao J, Gao GY, Jiang J.	J Neurotrauma.  2018	upregulated significantly after TBI	microarray, qRT-PCR	TBI rat model												
chr5:90817794|90827570	circRNA	rattus norvegicus						cardiovascular diseases	29521313	Identification of differentially expressed circular RNAs during TGF-beta1-induced endothelial-to-mesenchymal transition in rat coronary artery endothelial cells.	Huang X, Chen Y, Xiao J, Huang Z, He L, Xu D, Peng J.	Anatol J Cardiol.  2018	dramatically increased in TGF-¦Â1-treated rat CAEC compared with normal control group (p < 0.001). These results showed the same trend of high-throughput sequencing.	RNA-seq, qRT-PCR	TGF-¦Â1-treated rat coronary artery endothelial cells, controls												
chr6:22033342|22038870	circRNA	rattus norvegicus						cardiovascular diseases	29521313	Identification of differentially expressed circular RNAs during TGF-beta1-induced endothelial-to-mesenchymal transition in rat coronary artery endothelial cells.	Huang X, Chen Y, Xiao J, Huang Z, He L, Xu D, Peng J.	Anatol J Cardiol.  2018	dramatically increased in TGF-¦Â1-treated rat CAEC compared with normal control group (p < 0.001). These results showed the same trend of high-throughput sequencing.	RNA-seq, qRT-PCR	TGF-¦Â1-treated rat coronary artery endothelial cells, controls												
chr8:71336875|71337745	circRNA	rattus norvegicus						cardiovascular diseases	29521313	Identification of differentially expressed circular RNAs during TGF-beta1-induced endothelial-to-mesenchymal transition in rat coronary artery endothelial cells.	Huang X, Chen Y, Xiao J, Huang Z, He L, Xu D, Peng J.	Anatol J Cardiol.  2018	dramatically increased in TGF-¦Â1-treated rat CAEC compared with normal control group (p < 0.001). These results showed the same trend of high-throughput sequencing.	RNA-seq, qRT-PCR	TGF-¦Â1-treated rat coronary artery endothelial cells, controls												
rno_circRNA_000714	circRNA	rattus norvegicus						Cardiovascular and Renal Diseases	28778982	Circular RNAs in rat models of cardiovascular and renal diseases.	Cheng X, Joe B.	Physiol Genomics.  2017	This differentially expressed circRNA shown in the microarray analysis was further validated by qRT-PCR and qRT-PCR amplified circRNA products were further confirmed using gel electrophoresis.	microarray, qRT-PCR	the 25 spontaneously hypertensive rat (SHR) and the Wistar Kyoto rat (WKY).												
rno_circRNA_004637	circRNA	rattus norvegicus						Cardiovascular and Renal Diseases	28778982	Circular RNAs in rat models of cardiovascular and renal diseases.	Cheng X, Joe B.	Physiol Genomics.  2017	This differentially expressed circRNA shown in the microarray analysis was further validated by qRT-PCR and qRT-PCR amplified circRNA products were further confirmed using gel electrophoresis.	microarray, qRT-PCR	the 25 spontaneously hypertensive rat (SHR) and the Wistar Kyoto rat (WKY).												
rno_circRNA_006923	circRNA	rattus norvegicus						Cardiovascular and Renal Diseases	28778982	Circular RNAs in rat models of cardiovascular and renal diseases.	Cheng X, Joe B.	Physiol Genomics.  2017	This differentially expressed circRNA shown in the microarray analysis was further validated by qRT-PCR and qRT-PCR amplified circRNA products were further confirmed using gel electrophoresis.	microarray, qRT-PCR	the 25 spontaneously hypertensive rat (SHR) and the Wistar Kyoto rat (WKY).												
rno_circRNA_010885	circRNA	rattus norvegicus						Cardiovascular and Renal Diseases	28778982	Circular RNAs in rat models of cardiovascular and renal diseases.	Cheng X, Joe B.	Physiol Genomics.  2017	This differentially expressed circRNA shown in the microarray analysis was further validated by qRT-PCR and qRT-PCR amplified circRNA products were further confirmed using gel electrophoresis.	microarray, qRT-PCR	the 25 spontaneously hypertensive rat (SHR) and the Wistar Kyoto rat (WKY).												
rno_circRNA_010886	circRNA	rattus norvegicus						Cardiovascular and Renal Diseases	28778982	Circular RNAs in rat models of cardiovascular and renal diseases.	Cheng X, Joe B.	Physiol Genomics.  2017	This differentially expressed circRNA shown in the microarray analysis was further validated by qRT-PCR and qRT-PCR amplified circRNA products were further confirmed using gel electrophoresis.	microarray, qRT-PCR	the 25 spontaneously hypertensive rat (SHR) and the Wistar Kyoto rat (WKY).												
rno_circRNA_013859	circRNA	rattus norvegicus						Cardiovascular and Renal Diseases	28778982	Circular RNAs in rat models of cardiovascular and renal diseases.	Cheng X, Joe B.	Physiol Genomics.  2017	This differentially expressed circRNA shown in the microarray analysis was further validated by qRT-PCR and qRT-PCR amplified circRNA products were further confirmed using gel electrophoresis.	microarray, qRT-PCR	the 25 spontaneously hypertensive rat (SHR) and the Wistar Kyoto rat (WKY).												
rno_circRNA_004804	circRNA	rattus norvegicus						Cardiovascular and Renal Diseases	28778982	Circular RNAs in rat models of cardiovascular and renal diseases.	Cheng X, Joe B.	Physiol Genomics.  2017	This differentially expressed circRNA shown in the microarray analysis was further validated by qRT-PCR and qRT-PCR amplified circRNA products were further confirmed using gel electrophoresis.	microarray, qRT-PCR	the Dahl salt-sensitive rat (S), the Dahl salt-resistant rat (R)												
rno_circRNA_004811	circRNA	rattus norvegicus						Cardiovascular and Renal Diseases	28778982	Circular RNAs in rat models of cardiovascular and renal diseases.	Cheng X, Joe B.	Physiol Genomics.  2017	This differentially expressed circRNA shown in the microarray analysis was further validated by qRT-PCR and qRT-PCR amplified circRNA products were further confirmed using gel electrophoresis.	microarray, qRT-PCR	the Dahl salt-sensitive rat (S), the Dahl salt-resistant rat (R)												
rno_circRNA_014746	circRNA	rattus norvegicus						Cardiovascular and Renal Diseases	28778982	Circular RNAs in rat models of cardiovascular and renal diseases.	Cheng X, Joe B.	Physiol Genomics.  2017	This differentially expressed circRNA shown in the microarray analysis was further validated by qRT-PCR and qRT-PCR amplified circRNA products were further confirmed using gel electrophoresis.	microarray, qRT-PCR	the Dahl salt-sensitive rat (S), the Dahl salt-resistant rat (R)												
18:75429814|75430443	circRNA	rattus norvegicus						osteogenesis	28919414	Changes in related circular RNAs following ERβ knockdown and the relationship to rBMSC osteogenesis.	Li X, Peng B, Zhu X, Wang P, Xiong Y, Liu H, Sun K, Wang H, Ou L, Wu Z, Liu X, He H, Mo S, Peng X, Tian Y, Zhang R, Yang L.	Biochem Biophys Res Commun.  2017	up-regulated in samples from the ERb knockdown groups compared to controls.	qRT-PCR