RefCirc
a reference database for circRNAs validated by experiments

hsa_circ_0037911 Details

Basic Information
circRNA    hsa_circ_0037911
Alias    -
circBase ID    hsa_circ_0037911
Host gene    GSPT1
Species    homo sapiens
Peptide    -
Sequence  CACCTGTGGAATCCTCTCAAGAGGAACAGTCATTGTGTGAAGGTTCAAATTCAGCTGTTAGCATGGAACTTTCAGAACCTATTGTAGAAAATGGAGAGACAGAAATGTCTCCAGAAGAATCATGGGAGCACAAAGAAGAAATAAGTGAAGCAGAGCCAGGGGGTGGTTCCTTGGGAGATGGAAGGCCGCCAGAGGAAAGTGCCCATGAAATGATGGAGGAGGAAGAGGAAATCCCAAAACCTAAGTCTGTGGTTGCACCGCCAGGTGCTCCTAAGAAAGAGCATGTAAATGTAGTATTCATTGGGCACGTAGATGCTGGCAAGTCAACCATTGGAGGACAAATAAT

Expression
Description  The hsa_circ_0037911 expression level in EH cases were significantly higher than healthy controls (p = 0.005). There was still important significance when adjusted by logistic regression (adjusted p = 0.026). We also found that hsa_circ_0037911 was an effective marker of EH (area under curve = 0.627; p = 0.002). The levels of hsa_circ_0037911 were significantly differences in gender, BMI, smoking and drinking among EH cases. There was a positive correlation between Serum creatinine (Scr) and hsa_circ_0037911.
Method    qRT-PCR
Sample    blood samples of essential hypertension cases and controls

Function
Description  -
Method    -
in vitro    -
in vivo    -

Interaction
Target    -
Type    -
Sample    -
Experiment    -
Description    -
ceRNA target    -

Reference
Pubmed ID    29526758
Trait/Disease    Hypertension
Title    A potential risk factor of essential hypertension in case-control study: Circular RNA hsa_circ_0037911.
Authors    Bao X, Zheng S, Mao S, Gu T, Liu S, Sun J, Zhang L.
Journal    Biochem Biophys Res Commun. 2018