RefCirc
a reference database for circRNAs validated by experiments

circPRCKI Details
Basic Information
circRNA    circPRCKI
Alias    -
circBase ID    hsa_circ_0067934
Host gene    PRKCI
Species    homo sapiens
Peptide    -
Sequence  TTATTTTGGAAAAACAAATTCGCATACCACGTTCTCTGTCTGTAAAAGCTGCAAGTGTTCTGAAGAGTTTTCTTAATAAGGACCCTAAGGAACGATTGGGTTGTCATCCTCAAACAGGATTTGCTGATATTCAGGGACACCCGTTCTTCCGAAATGTTGATTGGGATATG
Expression
Description  circPRKCI is up-regulated in LAC tissues and positively correlated with tumor size and TNM stage.
Method    qRT-PCR
Sample    lung adenocarcinoma tissues
Function
Description  CircPRKCI promotes the proliferation and migration of LAC cell lines in vitro.CircPRKCI promotes cell proliferation via the circPRKCI-miR-545/589-E2F7 axis.
Method    loss of function, gain of function, mouse model
in vitro    A549, SPC-A1
in vivo    female BALB/c nude mice
Interaction
Target    miR-545, miR-589
Type    circRNA-miRNA
Sample    -
Experiment    -
Description    circPRKCI serves as a sponge for both miR-545 and miR-589
ceRNA target    E2F7
Reference
Pubmed ID    29588350
Trait/Disease    Lung Adenocarcinoma
Title    The circular RNA circPRKCI promotes tumor growth in lung adenocarcinoma.
Authors    Qiu M, Xia W, Chen R, Wang S, Xu Y, Ma Z, Xu W, Zhang E, Wang J, Fang T, Hu J, Dong G, Yin R, Wang J, Xu L.
Journal    Cancer Res. 2018