RefCirc
a reference database for circRNAs validated by experiments
| circPhf21a Details |
| Basic Information |
| circRNA | circPhf21a |
| Alias | mm9_circ_006097 |
| circBase ID | mmu_circ_0001047 |
| Host gene | Phf21a |
| Species | mus musculus |
| Peptide | - |
| Sequence | GGGACTGGAGAGCTGAAGGAGCGCCAGCTTCTCCAGAATTGGACTTCTCAGAACCTTTAATATGCTAATGTGCATTGTGAATCTCCAAGATGGGGATATGATATGCAGCATTCTTGAATACTTCTAATGACAGGGAGCCCACTACCTCATAAGCTGCAGCAACAAGAGGAGCTTGTAATTTTAAACGGAGGCTGAAGACACTGTAGAATTAGCAGACATAAGAGAGCGTGGAGAAGGCAGAGGATGGAGTTGCAGACTCTACAGGAGGCTCTTAAAGTGGAAATTCAGGTTCACCAGAAACTGGTTGCCCAAATGAAGCAGGATCCACAGAATGCTGACTTAAAGAAACAGCTTCATGAACTCCAAGCCAAAATCACAGCTTTGAGTGAGAAACAG |
| Expression |
| Description | By northern blots, using probes detecting both linear and circular isoforms, we validated this circRNA to be specifically enriched in the brain, although its linear isoform mostly show much broader expression patterns across tissues. circElf2 and circPhf21a showed predominant expression in the granular layer of cerebellum and olfactory bulb, consistent with qRT-PCR and northern blot analysis |
| Method | qRT-PCR, northern blots |
| Sample | P19 and SH-SY5Y cells, primary forebrain neurons from CD1 mouse embryos (E17.5-E18.5) |
| Reference |
| Pubmed ID | 25921068 |
| Trait/Disease | - |
| Title | Circular RNAs in the Mammalian Brain Are Highly Abundant, Conserved, and Dynamically Expressed. |
| Authors | Rybak-Wolf A, Stottmeister C, Gla??ar P, Jens M, Pino N, Giusti S, Hanan M, Behm M, Bartok O, Ashwal-Fluss R, Herzog M, Schreyer L, Papavasileiou P, Ivanov A, Ohman M, Refojo D, Kadener S, Rajewsky N. |
| Journal | Mol Cell. 2015 |