RefCirc
a reference database for circRNAs validated by experiments
| circRims2 Details |
| Basic Information |
| circRNA   |   circRims2 |
| Alias   |   mm9_circ_011266 |
| circBase ID   |   mmu_circ_0000595 |
| Host gene   |   Rims2 |
| Species   |   mus musculus |
| Peptide   |   - |
| Sequence   | GTGCTATGGATATAGAGGAGAGAAATCGCCAAATGAAACTTAACAAATACAAACAGGTAGCCGGATCAGACCCCAGACTGGAGCAAGATTACCATTCGAAGTATCGCTCAGGATGGGATCCACATAGAGGGGCAGATACTGTTTCCACTAAATCCTCGGACAGTGATGTAAGTGATGTATCTGCGGTTTCAAGGACTAGTAGTGCTTCTCGTTTCAGCAGCACAAGCTACATGTCCGTCCAATCAGAGCGGCCGAGAGGAAACAGGAAAATCAGTGTCTTTACATCCAAAATGCAAAACAGACAGATGGGCGTGTCGGGGAAGAACTTGACCAAAAGCACCAGCATCAGTGGAGACATGTGCTCACTGGAGAAGAATGACGGCAGCCAGTCCGACACTGCAGTGGGCGCCCTGGGTACCAGTGGCAAGAAGCGGCGATCTAGCATTGGGGCCAAAATGGTAGCTATTGTTGGTCTCTCACGGAAAAGTCGCAGTGCCTCTCAACTCAGCCAAACCG |
| Expression |
| Description   | A striking example is the mouse circRNA generated from Rims2. In the adult brain, it is expressed 20-fold higher than the linear mRNA, but is lowly expressed in other mouse tissues. By northern blots, using probes detecting both linear and circular isoforms, we validated this circRNA to be specifically enriched in the brain, although its linear isoform mostly show much broader expression patterns across tissues. We found several circRNAs enriched in specific brain regions independent of their linear isoforms. Some circRNAs were highly enriched in the cerebellum: circRims2, circElf2, and circDym, while circPlxnd1 was enriched in the cortex. circRims2 was detected exclusively in the granular layer of the cerebellum. |
| Method   |   qRT-PCR, northern blots |
| Sample   |   P19 and SH-SY5Y cells, primary forebrain neurons from CD1 mouse embryos (E17.5-E18.5) |
| Function |
| Interaction |
| Reference |
| Pubmed ID   |   25921068 |
| Trait/Disease   |   - |
| Title   |   Circular RNAs in the Mammalian Brain Are Highly Abundant, Conserved, and Dynamically Expressed. |
| Authors   |   Rybak-Wolf A, Stottmeister C, Glazar P, Jens M, Pino N, Giusti S, Hanan M, Behm M, Bartok O, Ashwal-Fluss R, Herzog M, Schreyer L, Papavasileiou P, Ivanov A, Ohman M, Refojo D, Kadener S, Rajewsky N. |
| Journal   |   Mol Cell. 2015 |