RefCirc
a reference database for circRNAs validated by experiments
| circStau2a Details |
| Basic Information |
| circRNA   |   circStau2a |
| Alias   |   mm9_circ_006026 |
| circBase ID   |   mmu_circ_0000013 |
| Host gene   |   Stau2 |
| Species   |   mus musculus |
| Peptide   |   - |
| Sequence   | TTTTGTGGAGCTGTGAGGGATACGGAAGTTTGATCAATATTGTCTTAACATGCTTCAGATAAATCAGCTTCTCTCCACGATAAAATGGCAAACCCCAAAGAGAAAACTCCAGTGTGTCTGGTAAATGAGTTAGCCCGTTTCCATAGCATCCAACCCCAGTATAAGCTTCTGAATGAAAGCGGGCCTGCTCATTCGAAGATGTTTTCGGTGCAGCTGAGTCTTGGCGAGCAGACATGGGAATCCGAAGGGAGCAGTATAAAGAAGGCCCAACAAGCTGTTGCTAACAAAGCTTTGACTGAATCTACGCTTCCCAAACCAGTTCAGAAACCACCTAAAAGTAATGTCAATAATAACCCAGGTAGTATAACTCCAACTGTGGAACTGAATGGGCTCGCTATGAAAAGGGGAGAGCCTGCCATCTACAGGCCACTAGATCCAAAGCCATTCCCAAATTATAGAGCTAACTACAACTTCCGGGGCATGTACAATCAGAG |
| Expression |
| Description   | Another example is two conserved circRNAs from the RNA-binding protein Staufen 2 gene, which show differential expression among the analyzed tissues. While the longer circRNA isoform (containing exons 2-5, circRNA stau2a) is expressed in the majority of adult mouse tissues, the shorter, consisting of exons 4 and 5 (circRNA stau2b), is predominantly expressed in embryonic stem (ES) cells, embryonic tissues, and lung. By northern blots, using probes detecting both linear and circular isoforms, we validated this circRNA to be specifically enriched in the brain, although its linear isoform mostly show much broader expression patterns across tissues. |
| Method   |   qRT-PCR, northern blots |
| Sample   |   P19 and SH-SY5Y cells, primary forebrain neurons from CD1 mouse embryos (E17.5-E18.5) |
| Function |
| Interaction |
| Reference |
| Pubmed ID   |   25921068 |
| Trait/Disease   |   - |
| Title   |   Circular RNAs in the Mammalian Brain Are Highly Abundant, Conserved, and Dynamically Expressed. |
| Authors   |   Rybak-Wolf A, Stottmeister C, Glazar P, Jens M, Pino N, Giusti S, Hanan M, Behm M, Bartok O, Ashwal-Fluss R, Herzog M, Schreyer L, Papavasileiou P, Ivanov A, Ohman M, Refojo D, Kadener S, Rajewsky N. |
| Journal   |   Mol Cell. 2015 |