RefCirc
a reference database for circRNAs validated by experiments
| circStau2b Details |
| Basic Information |
| circRNA | circStau2b |
| Alias | mm9_circ_000040 |
| circBase ID | mmu_circ_0000012 |
| Host gene | Stau2 |
| Species | mus musculus |
| Peptide | - |
| Sequence | ATGTTTTCGGTGCAGCTGAGTCTTGGCGAGCAGACATGGGAATCCGAAGGGAGCAGTATAAAGAAGGCCCAACAAGCTGTTGCTAACAAAGCTTTGACTGAATCTACGCTTCCCAAACCAGTTCAGAAACCACCTAAAAGTAATGTCAATAATAACCCAGGTAGTATAACTCCAACTGTGGAACTGAATGGGCTCGCTATGAAAAGGGGAGAGCCTGCCATCTACAGGCCACTAGATCCAAAGCCATTCCCAAATTATAGAGCTAACTACAACTTCCGGGGCATGTACAATCAGAG |
| Expression |
| Description | Another example is two conserved circRNAs from the RNA-binding protein Staufen 2 gene, which show differential expression among the analyzed tissues. While the longer circRNA isoform (containing exons 2-5, circRNA stau2a) is expressed in the majority of adult mouse tissues, the shorter, consisting of exons 4 and 5 (circRNA stau2b), is predominantly expressed in embryonic stem (ES) cells, embryonic tissues, and lung. |
| Method | qRT-PCR, northern blots |
| Sample | P19 and SH-SY5Y cells, primary forebrain neurons from CD1 mouse embryos (E17.5-E18.5) |
| Reference |
| Pubmed ID | 25921068 |
| Trait/Disease | - |
| Title | Circular RNAs in the Mammalian Brain Are Highly Abundant, Conserved, and Dynamically Expressed. |
| Authors | Rybak-Wolf A, Stottmeister C, Glazar P, Jens M, Pino N, Giusti S, Hanan M, Behm M, Bartok O, Ashwal-Fluss R, Herzog M, Schreyer L, Papavasileiou P, Ivanov A, Ohman M, Refojo D, Kadener S, Rajewsky N. |
| Journal | Mol Cell. 2015 |