RefCirc
a reference database for circRNAs validated by experiments
| circVim Details |
| Basic Information |
| circRNA | circVim |
| Alias | mm9_circ_016723 |
| circBase ID | mmu_circ_0000978 |
| Host gene | Vim |
| Species | mus musculus |
| Peptide | - |
| Sequence | ACATGGCTTCGAAGGTGGGCTGGCTTGCTGCGGCTGGAAAAACTGCAACAAGGGAATGAGGGCGCGGTGGCTGTGAATCGTAGGAGCGCTGGGGTCTCTGGG |
| Expression |
| Description | circVim was validated experimentally. |
| Method | qRT-PCR, northern blots |
| Sample | P19 and SH-SY5Y cells, primary forebrain neurons from CD1 mouse embryos (E17.5-E18.5) |
| Reference |
| Pubmed ID | 25921068 |
| Trait/Disease | - |
| Title | Circular RNAs in the Mammalian Brain Are Highly Abundant, Conserved, and Dynamically Expressed. |
| Authors | Rybak-Wolf A, Stottmeister C, Glazar P, Jens M, Pino N, Giusti S, Hanan M, Behm M, Bartok O, Ashwal-Fluss R, Herzog M, Schreyer L, Papavasileiou P, Ivanov A, Ohman M, Refojo D, Kadener S, Rajewsky N. |
| Journal | Mol Cell. 2015 |