RefCirc
a reference database for circRNAs validated by experiments

circAmotl1 Details
Basic Information
circRNA    circAmotl1
Alias    mm9_circ_000340
circBase ID    mmu_circ_0001745
Host gene    Amotl1
Species    mus musculus
Peptide    -
Sequence  CCGGCCCTGCCAGCTGCCTTTTCCATCTACGGTGCAGCAGCATAGCCCCATGTCCTCTCAGACCTCCTCCATCGGTGGTACTCTGCACTCCGTCTCCCTGCCTCTTCCACTTCCCATAAGCCTGGCGGCTTCACAGCCCCTACCAGCCTCCCCCAACCAGCAGCTTGGACCGGATGCCTTTGCGATTGTGGAGCGAGCCCAGCAAATGGTAGAGATCCTGACAGAGGAGAACCGTGTGCTTCACCAGGAGCTTCAGGGCTGCTATGACAACGCTGACAAGCTCCACAAGTTTGAAAAAGAGCTGCAGAGTATTTCGGAGGCCTACGAGAGCCTGGTCAAGTCCACCACCAAGCGTGAGTCTCTGGACAAGGCAATGAGAACCAAGCTCGAAGGCGAGATAAGGAGACTTCATGACTTCAACAGAGATCTCCGAGATCGACTGGAGACAGCCAACAGGCAGCTGTCCAGCAGGGAATACGATGGGCATGAAGACAAAGCTGCAGAGAGCCATTACGTGTCCCAGA
Expression
Description  -
Method    -
Sample    -
Function
Description  Expression of the circular RNA circ-Amotl1 accelerated healing process in a mouse excisional wound model. Further studies showed that ectopic circ-Amotl1 increased protein levels of Stat3 and Dnmt3a. circ-Amotl1 not only increased Stat3 expression but also facilitated Stat3 nuclear translocation. the ectopic expressed circ-Amotl1 and Stat3 were mainly translocated to nucleus. In the presence of circ-Amotl1, Stat3 interacted with Dnmt3a promoter with increased affinity, facilitating Dnmt3a transcription. Ectopic application of circ-Amotl1 accelerating wound repair may shed light on skin wound healing clinically.
Method    loss of function, gain of function
in vitro    NIH 3T3, HGF
in vivo    mouse model
Interaction
Target    Stat3
Type    circRNA-protein
Sample    -
Experiment    predicted
Description    The molecular simulation result supports that circ-Amotl1 could perfectly dock Stat3 and predicts a minimal binding region of circ-Amotl1 for Stat3: AACCTTCAC AAC AGGAAGAA. The contact map, the residue-level resolution contact maps (Figure S6C), the MC score, the contact distance, the accessible surface area, and the interaction overview all supported the conclusion that circ-Amotl1 sufficiently docked Stat3.
ceRNA target    -
Reference
Pubmed ID    28676341
Trait/Disease    Wound Healing
Title    The Circular RNA Interacts with STAT3, Increasing Its Nuclear Translocation and Wound Repair by Modulating Dnmt3a and miR-17 Function.
Authors    Yang ZG, Awan FM, Du WW, Zeng Y, Lyu J, Wu, Gupta S, Yang W, Yang BB.
Journal    Mol Ther. 2017