RefCirc
a reference database for circRNAs validated by experiments

mcircRasGEF1B Details
Basic Information
circRNA    mcircRasGEF1B
Alias    mm9_circ_015601
circBase ID    mmu_circ_0001367
Host gene    Rasgef1b
Species    mus musculus
Peptide    -
Sequence  GAAAGTATGCCTCAGACGCCCCCCTTCTCAGCAATGTTTGACAGCAGTGGCTACAACCGAAACCTCTACCAGTCCGCAGAGGACAGCTGTGGAGGCTTGTACTACCATGACAACAACCTCCTTTCTGGGTCTCTGGAAGCCCTTATCCAACACTTGGTACCCAATGTGGATTACTATCCTGATAGGACATACATCTTCACCTTCCTGCTTAGTTCTCGGTTATTCATGCATCCGTACGAGCTCATGGCTAAGGTTTGCCACCTGTGTGTTGAGCACCAGCGACTGAGTGAAGGGGACGGCGATAAGAACCAGATGAGAAAAATTGCACCTAAAATCCTTCAGCTCTTGACAGAGTGGACAGAAACATTTCCGTATGACTTCCGGGACGAGAGAATGATGAGGAACCTCAAGGACCTGGCGCACAGGATGGCCAGTGGCGAGGAG
Expression
Description  -
Method    -
Sample    -
Function
Description  Knockdown of mcircRasGEF1B results in altered expression of a wide array of genes. Pathway analysis revealed an overall enrichment of genes involved in cell cycle progression, mitotic division, active metabolism, and of particular interest, NF-??B, LPS signaling pathways, and macrophage activation. These findings expand the set of functionally characterized circRNAs and support the regulatory role of mcircRasGEF1B in immune response during macrophage activation and protection against microbial infections.
Method    loss of function
in vitro    RAW264.7 cells
in vivo    -
Interaction
Target    -
Type    -
Sample    -
Experiment    -
Description    -
ceRNA target    -
Reference
Pubmed ID    28947785
Trait/Disease    Microbial Infection
Title    Transcriptomic analysis of the role of RasGEF1B circular RNA in the TLR4/LPS pathway.
Authors    Ng WL, Marinov GK, Chin YM, Lim YY, Ea CK.
Journal    Sci Rep. 2017