RefCirc
a reference database for circRNAs validated by experiments

circDLGAP4 Details
Basic Information
circRNA    circDLGAP4
Alias    mm9_circ_015028
circBase ID    mmu_circ_0001098
Host gene    Dlgap4
Species    mus musculus
Peptide    -
Sequence  GTTCATCATGCCTAGTGGCATATAAGAAGACCCCACCACCGGTCCCTCCACGAACCACATCGAAACCGTTCATCTCAGTCACCGTCCAGAGCAGTACTGAGTCTGCTCAGGATACCTACCTGGACAGTCAAGACCACAAGAGCGAAGTGACGAGCCAGTCGGGCTTGAGCAACTCATCAGACAGCCTGGACAGCAGTACCCGGCCACCCAGTGTGACACGGGGTGGAATTACCCCAGGCCCTGAAGCTCCGGAGCCACCCCCTAAGCATGCAGCTCTGAAGAGTGAACAAGGGACACTGACGAGCTCTGAGTCCCATTCCGAGGCCATCCCCAAAAGGAAACTGTCATCGATAGGAATACAAGTTGACTGCATTCAGCCAGTGCCAAAAGAGGAGCCCAGTCCCGCTACCAAATTCCAGTCCATCGGGATTCAGGTAGAGGACGACTGGCGAAGCAGTGCCCCCTCTCACAGCATGTCCTCCCGTCGGGACACTGACTCTGATACCCAGGATGCCAACGACTCCAGTTGTAAGTCATCTGAGAGGAGTCTCCCAGACTGTACCTCACACCCCAATTCCATCAGCATTGATGCTGGCCCCCGACAGGCCCCCAAGATTGCCCAGATCAAGCGCAACCTCTCCTATGGAGACAACAGCGACCCTGCCCTGGAGGCGTCTTCGCTGCCCCCACCCGACCCTTGGCTGGAGACTTCCTCCAGCTCCCCAGCAGAGCCCGCTCAGCCAGGGGCCTGCCGCAGGGATGGCTACTGGTTCCTGAAGCTCCTTCAGGCAGAAACGGAGAGACTGGAAGGCTGGTGCTGCCAGATGGACAAGGAGACCAAAGAGAACAACCTCTCTGAAGAAG
Expression
Description  circDLGAP4 levels in these AIS subjects were significantly decreased compared with those in age- and gender-matched cognitively healthy controls. There were no gender-based differences in circDLGAP4 levels. Consistent with these clinical findings, circDLGAP4 expression levels were observed to be decreased in the ipsilateral hemispheres of mice with tMCAO compared with those in the sham group at 24 h after reperfusion. This was further confirmed by Northern blotting.
Method    qRT-PCR, northern blots
Sample    healthy controls and AIS patients, brain tissues of tMCAO mice
Function
Description  circRNA DLGAP4 (circDLGAP4) functions as an endogenous microRNA-143 (miR-143) sponge to inhibit miR-143 activity, resulting in the inhibition of homologous to the E6-APC-terminal domain E3 ubiquitin protein ligase 1 expression. Upregulation of circDLGAP4 expression significantly attenuated neurological deficits and decreased infarct areas and blood-brain barrier damage in the transient middle cerebral artery occlusion mouse stroke model. Endothelial-mesenchymal transition contributes to blood-brain barrier disruption and circDLGAP4 overexpression significantly inhibited endothelial-mesenchymal transition by regulating tight junction protein and mesenchymal cell marker expression.
Method    gain of function
in vitro    HEK293T, bEnd.3
in vivo    tMCAO mice
Interaction
Target    miR-143
Type    circRNA-miRNA
Sample    HEK293T, bEnd.3
Experiment    RNA pull-down, FISH
Description    More circDLGAP4 enrichment was detected in the miR-143-captured fraction than in the fractions in which mutations disrupted base-pairing between circDLGAP4 and miR-143 in both HEK293T and bEnd.3 cells. This finding was further confirmed via FISH, demonstrated by colocalization between circDLGAP4 and miR-143 in cytoplasm.
ceRNA target    HECTD1
Reference
Pubmed ID    29114076
Trait/Disease    Acute Ischemic Stroke
Title    Circular RNA DLGAP4 Ameliorates Ischemic Stroke Outcomes by Targeting miR-143 to Regulate Endothelial-Mesenchymal Transition Associated with Blood-Brain Barrier Integrity.
Authors    Bai Y, Zhang Y, Han B, Yang L, Chen X, Huang R, Wu F, Chao J, Liu P, Hu G, Zhang JH, Yao H.
Journal    J Neurosci. 2018