RefCirc
a reference database for circRNAs validated by experiments
mmu_circ_0001152 Details |
Basic Information |
circRNA   |   mmu_circ_0001152 |
Alias   |   mm9_circ_006065 |
circBase ID   |   mmu_circ_0001152 |
Host gene   |   Fam46c |
Species   |   mus musculus |
Peptide   |   - |
Sequence   | CTGTCTAGGGGCCGCAGTCTCCGCTCCGCTCCTGCTGGGGGCTGCCCACGCCAACCACCTGCCTCAGTCACCTCCTCTTCCAACGCCCAG |
Expression |
Description   | The expressions of the circRNA was examined in mice of 60 WLM group. |
Method   |   microarray, qRT-PCR |
Sample   |   BALB/c mice lung tissue |
Function |
Interaction |
Reference |
Pubmed ID   |   29165116 |
Trait/Disease   |   Pulmonary Toxicity Induced By Radon |
Title   |   Circular RNA profiles in mouse lung tissue induced by radon. |
Authors   |   Pei W, Tao L, Zhang LW, Zhang S, Cao J, Jiao Y, Tong J, Nie J. |
Journal   |   Environ Health Prev Med. 2017 |