RefCirc
a reference database for circRNAs validated by experiments

mmu_circHECTD1 Details
Basic Information
circRNA    mmu_circHECTD1
Alias    mm9_circ_002888
circBase ID    mmu_circ_0000375
Host gene    Hectd1
Species    mus musculus
Peptide    -
Sequence  GAAGAAGAAGAGTATGAAACCAAAGGAGGCCGCCGCAGAGCCTGGGATGACGACTATGTGCTAAAGCGCCAGTTTTCTGCACTGGTCCCTGCTTTTGATCCTAGACCTGGTCGTACCAATGTCCAGCAGACAACTGACCTAGAAATTCCTCCCCCAGGAACACCTCACTCAGAGCTCTTGGAGGAAGTTGAATGTACTCCGTCACCTCGCTTGGCTCTCACACTGAAAGTGACGGGGCTTGGAACAACGCGGGAAGTTGAACTGCCACTTACCAATTTCAGATCCACCATCTTTTACTATGTACAAAAACTGCTTCAACTGTCTTGTAATGGCAATGTGAAGTCAGATAAACTTAGGCGTATTTGGGAGCCCACTTACAC
Expression
Description  mmu_circHECTD1 expression varied in the lungs of mice in the NS group and SiO2 group. mmu_circHECTD1 expression decreased after 24 h of SiO2 exposure in RAW264.7 cells. These results were confirmed in a fluorescence in situ hybridization (FISH) assay, in which mmu_circHECTD1 was mainly detected in the cytoplasm of RAW264.7 cells. mmu_circHECTD1 was significantly decreased after 7 and 28 days compared with the levels in NS-treated mice.
Method    microarray, qRT-PCR, FISH
Sample    the lungs of mice, RAW264.7 cells
Function
Description  SiO2 concomitantly decreased circHECTD1 levels and increased HECTD1 protein expression. circHECTD1 and HECTD1 were involved in SiO2-induced macrophage activation via ubiquitination; and SiO2-activated macrophages promoted fibroblast proliferation and migration via the circHECTD1/HECTD1 pathway. Tissue samples from silicosis patients confirmed the upregulation of HECTD1.
Method    loss of function, gain of function
in vitro    RAW264.7 cells,
in vivo    mouse lungs
Interaction
Target    ZC3H12A
Type    circRNA-protein
Sample    RAW264.7 cells
Experiment    RIP
Description    ZC3H12A interacted with circHECTD1 but not HECTD1 mRNA.
ceRNA target    -
Reference
Pubmed ID    29290828
Trait/Disease    Silicosis
Title    circRNA Mediates Silica-Induced Macrophage Activation Via HECTD1/ZC3H12A-Dependent Ubiquitination.
Authors    Zhou Z, Jiang R, Yang X, Guo H, Fang S, Zhang Y, Cheng Y, Wang J, Yao H, Chao J.
Journal    Theranostics. 2018