RefCirc
a reference database for circRNAs validated by experiments

circRNA_Atp9b Details
Basic Information
circRNA    circRNA_Atp9b
Alias    -
circBase ID    -
Host gene    Atp9b
Species    mus musculus
Peptide    -
Sequence  TTGGCAGTCTGCGAGTAAACTTGGATATGGGCAAAGCAGCATATGGATGGATGATTATGAAAGATGAGAATATTCCTGGTACAGTTGTTCGGACCAGCACAATACCAGAAGAACTTGGACGCCTGGTGTACTTACTGACAGACAAAACAG*GTAAAGTTCAAGTTAAGAGCTCAGACATACAAGTTGGAGACCTCATCATAGTGGAAAAGGTTGATACATTTTTTTAATATATTTTAAATCTGTATGTTCAACAGTCATTAACATTAGCTTAATTACAAGTAACGTTAACTTCAAATGAAC
Expression
Description  Compared with the normal control group, circRNA_Atp9b expression levels were significantly up-regulated in IL-1??-induced chondrocytes in a time-dependent manner.
Method    qRT-PCR
Sample    chondrocytes
Function
Description  Knockdown of circRNA_Atp9b promoted the expression of type II collagen while inhibiting the generation of MMP13, COX-2 and IL-6. circRNA_Atp9b regulates OA progression by modulating ECM catabolism and inflammation in chondrocytes via sponging miR-138-5p.
Method    loss of function
in vitro    chondrocytes
in vivo    -
Interaction
Target    miR-138-5p
Type    circRNA-miRNA
Sample    chondrocytes
Experiment    luciferase reporter assay
Description    these results illustrate that circRNA_Atp9b directly targets miR-138-5p by functioning as sponge.
ceRNA target    -
Reference
Pubmed ID    29305974
Trait/Disease    Osteoarthritis
Title    Circular RNA Atp9b, a competing endogenous RNA, regulates the progression of osteoarthritis by targeting miR-138-5p.
Authors    Zhou ZB, Du D, Huang GX, Chen A, Zhu L.
Journal    Gene. 2018