RefCirc
a reference database for circRNAs validated by experiments
| tric31905 Details |
| Basic Information |
| circRNA | tric31905 |
| Alias | - |
| circBase ID | - |
| Host gene | CR31905 |
| Species | drosophila melanogaster |
| Peptide | - |
| Sequence | AGTTTCCGAGGCTTGGTGATGCGAGCAGAGGCAGGACTCTGGGCCAAACAATACCATGGCCCCAGATAGCGCTTGCTCTTGTTTCATCAGTTAGTGAATCGCGATATGTTGAA |
| Expression |
| Description | Collectively, these experiments demonstrate that splicing of the CR31905 transcript generates a stable intronic RNA, termed tric31905, and that the predominant form of this molecule is circular. We examined expression of tric31905 over developmental time and found that its levels increase substantially from embryos to adults. In contrast, expression of the mature tRNA (TyrGUA) was relatively constant. Notably, tric31905 expression was slightly lower in adult females, perhaps because the ovary is such a large organ and expression levels in these tissues were relatively low. Consistent with their embryonic origin, Schneider2 cells also showed relatively low levels. |
| Method | qRT-PCR, northern blots |
| Sample | fly larvae, pupae and adults |
| Reference |
| Pubmed ID | 26194134 |
| Trait/Disease | - |
| Title | Metazoan tRNA introns generate stable circular RNAs in vivo. |
| Authors | Lu Z, Filonov GS, Noto JJ, Schmidt CA, Hatkevich TL, Wen Y, Jaffrey SR, Matera AG. |
| Journal | RNA. 2015 |