RefCirc
a reference database for circRNAs validated by experiments

circRNA-CER Details
Basic Information
circRNA    circRNA-CER
Alias    circRNA_100876
circBase ID    hsa_circ_0023404
Host gene    RNF121
Species    homo sapiens
Peptide    -
Sequence  GTTGATATGTCAGATCTCTCTCCAGAAGAGCAATGGAGGGTCGAGCACGCACGCATGCATGCCAAGCACCGTGGCCATGAAGCTATGCATGCTGAAATGGTCCTCATCCTCATCGCAACCTTGGTGGTGGCCCAGCTGCTCCTGGTGCAGTGGAAGCAGAGGCACCCACGCTCCTACAAT
Expression
Description  up-regulated in OA with 2.5-fold change by qPCR
Method    qRT-PCR
Sample    osteoarthritis
Function
Description  Silencing of circRNA-CER using small interfering RNA suppressed MMP13 expression and increased ECM formation. CircRNA-CER could compete for miR-136 with MMP13. circRNA-CER regulated MMP13 expression by functioning as a competing endogenous RNA (ceRNA) and participated in the process of chondrocyte ECM degradation.
Method    loss of function
in vitro    OA chondrocytes
in vivo    -
Interaction
Target    miR-136
Type    circRNA-miRNA
Sample    OA chondrocytes
Experiment    luciferase reporter assay
Description    CircRNA-CER is targeted by MMP13-targeting miRNAs.
ceRNA target    MMP13
Reference
Pubmed ID    26931159
Trait/Disease    Cartilage Degradation
Title    Circular RNA Related to the Chondrocyte ECM Regulates MMP13 Expression by Functioning as a MiR-136 Sponge in Human Cartilage Degradation.
Authors    Liu Q, Zhang X, Hu X, Dai L, Fu X, Zhang J, Ao Y.
Journal    Sci Rep. 2016