RefCirc
a reference database for circRNAs validated by experiments

f-circM9_1 Details
Basic Information
circRNA    f-circM9_1
Alias    -
circBase ID    -
Host gene    MLL-AF9 fusion gene
Species    homo sapiens
Peptide    -
Sequence  CTNTTGGANTCNGGCCCAGGGGCCGAGACATTCCCTTCTTCACTCTTTTCCTCGACGGGCTTTCGTGGAGGAGGCTCACTACTGCTTTTCTTTGGGGCAGGATCCTCTCTTGCTGATGGGGTAGGTTTCTGACTAGAGTCCACCACGTTCTTCACAACACTGCTCTCTTTGCTGTCTTTCTTTTCACTGGTCTTAGACTTTTTCTCTTTCTTTTTCACAGCTTGTTGCCTGGTCTGGGAT
Expression
Description  f-circM9_1 is expressed in THP1 cells.
Method    PCR products sequencing
Sample    THP1 cell line, MEFs, HSCs, mouse model
Function
Description  f-circM exerts tumor promoting activity in immortalized MEFs and is involved in the tumorigenic process independent of their linear transcript and their fusion protein counterparts. f-circM9, when coupled with other oncogenic stimuli (e.g., the presence of the oncogenic fusion protein), plays an active role in favoring leukemia progression in vivo. f-circM9 also provides tumor cells a survival advantage in response to therapy treatment, likely impacting therapeutic outcomes and palys an important role in maintaining the viability of leukemic cells.
Method    loss of function, gain of function
in vitro    THP1 cell line, MEFs, HSCs, mouse model
in vivo    -
Interaction
Target    -
Type    -
Sample    -
Experiment    -
Description    -
ceRNA target    -
Reference
Pubmed ID    27040497
Trait/Disease    Acute Myeloid Leukemia
Title    Oncogenic Role of Fusion-circRNAs Derived from Cancer-Associated Chromosomal Translocations.
Authors    Guarnerio J, Bezzi M, Jeong JC, Paffenholz SV, Berry K, Naldini MM, Lo-Coco F, Tay Y, Beck AH, Pandolfi PP.
Journal    Cell. 2016