RefCirc
a reference database for circRNAs validated by experiments
| circ-ASXL1 Details |
| Basic Information |
| circRNA   |   circ-ASXL1 |
| Alias   |   hsa_circ_002158 |
| circBase ID   |   hsa_circ_0001136 |
| Host gene   |   ASXL1 |
| Species   |   homo sapiens |
| Peptide   |   - |
| Sequence   | GTATTAGAAAACTACTCGGATGCTCCAATGACACCAAAACAGATTCTGCAGGTCATAGAGGCAGAAGGACTAAAGGAAATGAGCAGTGGGACTTCCCCTCTCGCATGCCTCAATGCTATGCTACATTCCAATTCAAGAGGAGGAGAGGGGTTGTTTTATAAACTGCCTGGCCGAATCAGCCTTTTCACGCTCAAG |
| Expression |
| Description   | first confirmed the presence of the ASXL1 circular isoformthat is composed of exons 2 and 3 using RNAse R |
| Method   |   RT-PCR, sequencing |
| Sample   |   HeLa |
| Function |
| Interaction |
| Reference |
| Pubmed ID   |   27736885 |
| Trait/Disease   |   - |
| Title   |   Dynamic ASXL1 Exon Skipping and Alternative Circular Splicing in Single Human Cells. |
| Authors   |   Koh W, Gonzalez V, Natarajan S, Carter R, Brown PO, Gawad C. |
| Journal   |   PLoS One. 2016 |