RefCirc
a reference database for circRNAs validated by experiments

hsa_circ_0067934 Details
Basic Information
circRNA    hsa_circ_0067934
Alias    -
circBase ID    hsa_circ_0067934
Host gene    PRKCI
Species    homo sapiens
Peptide    -
Sequence  TTATTTTGGAAAAACAAATTCGCATACCACGTTCTCTGTCTGTAAAAGCTGCAAGTGTTCTGAAGAGTTTTCTTAATAAGGACCCTAAGGAACGATTGGGTTGTCATCCTCAAACAGGATTTGCTGATATTCAGGGACACCCGTTCTTCCGAAATGTTGATTGGGATATG
Expression
Description  upregulated in esophageal squamous cellcarcinoma
Method    qRT-PCR, FISH
Sample    primary ESCC tissues and adjacent normal tissues, HEEC, TE-1, KSYE410, TE-13, ECA-109
Function
Description  The high expression level of hsa_circ_0067934 was associated with poor differentiation (P = 0.025), I-II T stage (P = 0.04), and I-II TNM stage (P = 0.021). The in vitro silence of hsa_circ_0067934 by siRNA inhibited the proliferation and migration of ESCC cells and blocked cell cycle progression.
Method    loss of function
in vitro    ECA-109, TE-13
in vivo    -
Interaction
Target    -
Type    -
Sample    -
Experiment    -
Description    -
ceRNA target    -
Reference
Pubmed ID    27752108
Trait/Disease    Esophageal Squamous Cell Carcinoma
Title    Circular RNA has_circ_0067934 is upregulated in esophageal squamous cell carcinoma and promoted proliferation.
Authors    Xia W, Qiu M, Chen R, Wang S, Leng X, Wang J, Xu Y, Hu J, Dong G, Xu PL, Yin R.
Journal    Sci Rep. 2016