RefCirc
a reference database for circRNAs validated by experiments

CircPVT1 Details
Basic Information
circRNA    CircPVT1
Alias    hsa_circ_000006
circBase ID    hsa_circ_0001821
Host gene    TCONS_00015354
Species    homo sapiens
Peptide    -
Sequence  GCCTGATCTTTTGGCCAGAAGGAGATTAAAAAGATGCCCCTCAAGATGGCTGTGCCTGTCAGCTGCATGGAGCTTCGTTCAAGTATTTTCTGAGCCTGATGGATTTACAGTGATCTTCAGTGGTCTGGGGAATAACGCTGGTGGAACCATGCACTGGAATGACACACGCCCGGCACATTTCAGGATACTAAAAGTGGTTTTAAGGGAGGCTGTGGCTGAATGCCTCATGGATTCTTACAGCTTGGATGTCCATGGGGGACGAAGGACTGCAGCTGGCTGAGAGGGTTGAGATCTCTGTTTACTTAGATCTCTGCCAACTTCCTTTGGGTCTCCCTATGGAATGTAAGACCCCGACTCTTCCTGGTGAAGCATCTGATGCACGTTCCATCCGGCGCTCAGCTGGGCTTGAG
Expression
Description  the circRNA hsa_circ_PVT1_01 was found to be one of the most downregulated circRNAs in senescent WI-38 cells. To further validate the association of circRNA expression with cellular senescence, we induced premature senescence by exposing proliferating WI-38 cells to ionizing radiation (IR). IR-treated cells were found to have higher SA- gal activity and other markers of senescence. Most of the circRNAs showed consistent patterns of expression in replicative and IR-induced senescence, including hsa_circ_PVT1|_01, which was reduced in both instances.
Method    qRT-PCR
Sample    WI-38 cells
Function
Description  Reducing CircPVT1 levels in proliferating fibroblasts triggered senescence, as determined by a rise in senescence-associated beta-galactosidase activity, higher abundance of CDKN1A/P21 and TP53, and reduced cell proliferation. Reporter analysis revealed that CircPVT1 decreased the cellular pool of available let-7, and antagonizing endogenous let-7 triggered cell proliferation. Importantly, silencing CircPVT1 promoted cell senescence and reversed the proliferative phenotype observed after let-7 function was impaired. Consequently, the levels of several proliferative proteins that prevent senescence, such as IGF2BP1, KRAS and HMGA2, encoded by let-7 target mRNAs, were reduced by silencing CircPVT1.
Method    loss of function
in vitro    human WI-38 fibroblasts, MCF7 breast carcinoma cells, and IMR-90 lung fibroblasts
in vivo    -
Interaction
Target    let-7
Type    circRNA-miRNA
Sample    human WI-38 fibroblasts
Experiment    RNA pull-down
Description    Although several microRNAs were predicted to bind CircPVT1, only let-7 was found enriched after pulldown of endogenous CircPVT1, suggesting that CircPVT1 might selectivelymodulate let-7 activity and hence expression of let-7-regulated mRNAs.
ceRNA target    IGF2BP1, KRAS and HMGA2.
Reference
Pubmed ID    27928058
Trait/Disease    Senescence
Title    Identification of senescence-associated circular RNAs (SAC-RNAs) reveals senescence suppressor CircPVT1.
Authors    Panda AC, Grammatikakis I, Kim KM, De S, Martindale JL, Munk R, Yang X, Abdelmohsen K, Gorospe M.
Journal    Nucleic Acids Res. 2017