RefCirc
a reference database for circRNAs validated by experiments
| has_circ_0063592 Details |
| Basic Information |
| circRNA   |   has_circ_0063592 |
| Alias   |   - |
| circBase ID   |   hsa_circ_0063592 |
| Host gene   |   XRCC6 |
| Species   |   homo sapiens |
| Peptide   |   - |
| Sequence   | GCTTCCAGCTGGTCTTTTTACCCTTTGCTGATGATAAAAGGAAGATGCCCTTTACTGAAAAAATCATGGCAACTCCAGAGCAGGTGGGCAAGATGAAGGCTATCGTTGAGAAGCTTCGCTTCACATACAGAAGTGACAGCTTTGAGAACCCCGTGCTGCAGCAGCACTTCAGGAACCTGGAGGCCTTGGCCTTGGATTTGATGGAGCCGGAACAAGCAGTGGACCTGACAT |
| Expression |
| Description   | To validate these predicted circRNAs, 55 circRNAs of different abundance and lengths were randomly chosen for subsequent RT-PCR validation. Divergent primers were designed for circRNA detection. Among the 55 circRNAs, 30 of them could be specifically amplified. |
| Method   |   qRT-PCR |
| Sample   |   human testis |
| Function |
| Interaction |
| Reference |
| Pubmed ID   |   27958373 |
| Trait/Disease   |   Male Infertility |
| Title   |   Identification and characterization of human testis derived circular RNAs and their existence in seminal plasma. |
| Authors   |   Dong WW, Li HM, Qing XR, Huang DH, Li HG. |
| Journal   |   Sci Rep. 2016 |