RefCirc
a reference database for circRNAs validated by experiments
hsa_circ_0063591 Details |
Basic Information |
circRNA   |   hsa_circ_0063591 |
Alias   |   - |
circBase ID   |   hsa_circ_0063591 |
Host gene   |   XRCC6 |
Species   |   homo sapiens |
Peptide   |   - |
Sequence   | ATCTATGGGAGTCGTCAGATTATACTGGAGAAAGAGGAAACAGAAGAGCTAAAACGGTTTGATGATCCAGGTTTGATGCTCATGGGTTTCAAGCCGTTGGTACTGCTGAAGAAACACCATTACCTGAGGCCCTCCCTGTTCGTGTACCCAGAGGAGTCGCTGGTGATTG |
Expression |
Description   | To validate these predicted circRNAs, 55 circRNAs of different abundance and lengths were randomly chosen for subsequent RT-PCR validation. Divergent primers were designed for circRNA detection. Among the 55 circRNAs, 30 of them could be specifically amplified. |
Method   |   qRT-PCR |
Sample   |   human testis |
Function |
Interaction |
Reference |
Pubmed ID   |   27958373 |
Trait/Disease   |   Male Infertility |
Title   |   Identification and characterization of human testis derived circular RNAs and their existence in seminal plasma. |
Authors   |   Dong WW, Li HM, Qing XR, Huang DH, Li HG. |
Journal   |   Sci Rep. 2016 |