RefCirc
a reference database for circRNAs validated by experiments

CircPABPN1 Details
Basic Information
circRNA    CircPABPN1
Alias    -
circBase ID    hsa_circ_0031288
Host gene    PABPN1
Species    homo sapiens
Peptide    -
Sequence  GTGATCCCAAAACGAACCAACAGACCAGGCATCAGCACAACAGACCGGGGTTTTCCACGAGCCCGCTACCGCGCCCGGACCACCAACTACAACAGCTCCCGCTCTCGATTCTACAGTGGTTTTAACAGCAGGCCCCGGGGTCGCGTCTACAG
Expression
Description  This circRNA originates from Poly(A)-binding protein nuclear 1 (PABPN1) pre-mRNA and thus we named it CircPABPN1. Further analyses included specific CircPABPN1 RT-qPCR amplification, visualization on agarose gels (with no amplification in -RT reactions), and sequencing of the amplified PCR product to verify the specific circRNA junction. Digestion of total RNA with RNase R to degrade linear RNAs followed by RT-qPCR analysis indicated that CircPABPN1 was protected from RNase R digestion, while GAPDH and PABPN1 mRNAs were degraded.
Method    qRT-PCR
Sample    HeLa
Function
Description  HuR did not influence CircPABPN1 abundance; interestingly, however, high levels of CircPABPN1 suppressed HuR binding to PABPN1 mRNA. Evaluation of PABPN1 mRNA polysomes indicated that PABPN1 translation was modulated positively by HuR and hence negatively by CircPABPN1.
Method    -
in vitro    HeLa
in vivo    -
Interaction
Target    HuR
Type    circRNA-protein
Sample    HeLa
Experiment    Biotin pull-down assay
Description    endogenous HuR can bind to cellular circRNAs and reveal strong binding of CircPABPN1 to HuR, as determined using microarrays and RTqPCR analyses, sequencing of circRNA junctions, and biotinylated-RNA pulldown analysis.
ceRNA target    -
Reference
Pubmed ID    28080204
Trait/Disease    -
Title    Identification of HuR target circular RNAs uncovers suppression of PABPN1 translation by CircPABPN1.
Authors    Abdelmohsen K, Panda AC, Munk R, Grammatikakis I, Dudekula DB, De S, Kim J, Noh JH, Kim KM, Martindale JL, Gorospe M.
Journal    RNA Biol. 2017