RefCirc
a reference database for circRNAs validated by experiments

hsa_circ_0005105 Details
Basic Information
circRNA    hsa_circ_0005105
Alias    -
circBase ID    hsa_circ_0005105
Host gene    SEC24A
Species    homo sapiens
Peptide    -
Sequence  TTACGACCACCTCAGCCTCCAGTGTATCTCTTTGTATTTGATGTGTCTCACAATGCAGTCGAAACTGGATACTTGAATTCAGTTTGCCAGAGTTTGTTAGACAATCTGGATTTGCTTCCTGGCAACACTAGAACAAAAATTGGCTTCATAACATTTGACAGTACAATCCATTTCTACGGTCTTCAGGAAAGTCTCTCTCAACCTCAGATGCTAATAGTTTCAGATATTGAAG
Expression
Description  IL-1beta can significantly promote hsa_circ_0005105 expression in chondrocytes in a time dependent manner.
Method    qRT-PCR
Sample    chondrocytes
Function
Description  hsa_circ_0005105 can inhibit the expression of type II collagen and aggrecan, promote the expression of MMP-13 and ADAMTS-4, and the generation of PGE2, IL-6, and IL-8, but the linear sequence of hsa_circ_0005105 cannot.
Method    loss of function, gain of function
in vitro    chondrocytes
in vivo    -
Interaction
Target    miR-26a
Type    circRNA-miRNA
Sample    chondrocytes
Experiment    luciferase reporter assay
Description    the results of dualluciferase reporter assay confirmed that hsa_circ_0005105 had miR-26a binding sites
ceRNA target    NAMPT
Reference
Pubmed ID    28276108
Trait/Disease    Osteoarthritis
Title    CircRNA hsa_circ_0005105 upregulates NAMPT expression and promotes chondrocyte extracellular matrix degradation by sponging miR-26a.
Authors    Wu Y, Zhang Y, Zhang Y, Wang JJ.
Journal    Cell Biol Int. 2017