RefCirc
a reference database for circRNAs validated by experiments
| hsa_circRNA_001379 Details |
| Basic Information |
| circRNA   |   hsa_circRNA_001379 |
| Alias   |   hsa_circ_001379 |
| circBase ID   |   hsa_circ_0000516 |
| Host gene   |   RPPH1 |
| Species   |   homo sapiens |
| Peptide   |   - |
| Sequence   | TCTGACCTCGCGCGGAGCCCCGTTCTCTGGGAACTCACCTCCCCGAAGCTCAGGGAGAGCCCTGTTAGGGCCGCCTCTGGCCCTA |
| Expression |
| Description   | upregulated |
| Method   |   microarray, qRT-PCR |
| Sample   |   PTC tumors, matching contralateral normal samples, benign thyroid lesions (i.e., follicular adenoma samples and multinodular goiter samples) |
| Function |
| Interaction |
| Reference |
| Pubmed ID   |   28288173 |
| Trait/Disease   |   Papillary Thyroid Carcinoma |
| Title   |   Microarray profiling of circular RNAs in human papillary thyroid carcinoma. |
| Authors   |   Peng N, Shi L, Zhang Q, Hu Y, Wang N, Ye H. |
| Journal   |   PLoS One. 2017 |