RefCirc
a reference database for circRNAs validated by experiments

ciRS-7 Details
Basic Information
circRNA    ciRS-7
Alias    CDR1as
circBase ID    hsa_circ_0001946
Host gene    CDR1
Species    homo sapiens
Peptide    -
Sequence  GGTTTCCGATGGCACCTGTGTCAAGGTCTTCCAACAACTCCGGGTCTTCCAGCGACTTCAAGTCTTCCAATAATCTCAAGGTCTTCCAGATAATCCTGAGCTTCCAGAAAATCCACATCTTCCAGACAATCCATGTCTTCCGGACAATCCATGTCTTCCAAGAAGCTCCAAGTCTTCCAGTAAATCAAGTCTTCCAGCAAATCCAGTCTTCCAGCAATTACTGGTCTTCCACCAAATCCAGATCTTCCAGGAAAATCCACGTCTTCCAGGAAATCCATGTCTTCCAATAATTTCAAGGTCTTCCATCAAATACAGATCTTCCAGCTAATCCATGTCTTCCAGAAAAATCTGTGTCTTCCACCAAATCCAAGTCTTCCAGTAAATCTAGTTCTTCCAGAAAAATCTAGATCTTCCAGTCAATCAGTGTCTTCCAGAAAGAAATCCAGGTCTTCCAGTCAATCAGTGTCTTCCAGAAAGAAATCCAGGTCTTCCAGTCAGTCAGTGTCTTCCAGAAAAATCTACGTCTTCCACCAAATCCAGGTCTTCCAGTCAATCCACATCTTCCGGAAAAAATCCAGGTCTTCCAGCCAATATATGTCTTCCTGAAGATCCACGTCTTCCAGAAAATCCATGTCTTCCAGAAAATCCATGTCTTCCAGTAACCTCCCAGTCTTCCAGAAAATCCACGTCTTCCCAACAATCCAAGTCTTCCGGATAATTTGGGTCTTCCTGAAAATCTACGTCTTCCAAAAAAGCCATGTCTTCCAGAAAATCCACATCTTCCAATGGCCTCCAGGTCTTCCAGACTATCCATGTCTTCCAGAAAATCCTTGTCTTCCCTTAAATCTATAGCTTCCAAAAAATCCGGGTCTTCCAGGAAATCCGTGTCTTCCAGCAAGTCCACGTCTTCCAACAAAGCCATGTCTTCCAGACTATCCATGTCTTCCAGAAAATCCTTGTCTTCCCTCAAATCCATAGCTTCCGAAAAATCCAGGTCTTCCAGGAAATCCGTGTCTTCCAGCAAATCCACGTCTTCCAACAAAGCCATGTCTTCCATCAAATTAATGTCTTCCAGCCTACTTGTGTCTTCCAACAAAGGTACGTCTTCCAACAAAGGTACGTCTTCCAACAAAGGTATGTCTTCCAACAAAGGTACGTCTTCCAGAAAATCCACGTCTTCCAACCAAGCCATGTCTTCCAGAAAATCCACGTCTTCCAGAAAATATATGTCTTCCAACTAAGCTACGTCTTCCAACAAATCCATGTCTTCCTATATCTCCAGGTCTTCCAGCATCTCCAGGGCTTCCAGCATCTGCTCGTCTTCCAACATCTCCACGTCTTCCAGCATCTCTGTGTCTTCCAGCATCTTCATGTCTTCCAACAACTACCCAGTCTTCCATCAACTGGCTCAATATCCATGTCTTCCAACGTCTCCAGTGTGCTGATCTTCTGACATTCAGGTCTTCCAGTGTCTGCAATATCCAG
Expression
Description  ciRS-7, which is highly expressed in the human brain, is down-regulated in the brain of people with AD. APP reduces the level of ciRS-7.
Method    qRT-PCR
Sample    HEK293T, SH-SY5Y
Function
Description  We have found that ciRS-7 is not involved in the regulation of APP and BACE1 gene expression, but instead reduces the protein levels of APP and BACE1 by promoting their degradation via the proteasome and lysosome. Consequently, overexpression of ciRS-7 reduces the generation of Ab, indicating a potential neuroprotective role of ciRS-7. Our data also suggest that ciRS-7 modulates APP and BACE1 levels in a nuclear factor-kapaB (NF-kapaB)-dependent manner: ciRS-7 expression inhibits translation of NF-kapaB and induces its cytoplasmic localization, thus derepressing expression of UCHL1, which promotes APP and BACE1 degradation. Additionally, we demonstrated that APP reduces the level of ciRS-7, revealing a mutual regulation of ciRS-7 and APP.
Method    loss of function, gain of function
in vitro    HEK293T, SH-SY5Y
in vivo    -
Interaction
Target    -
Type    -
Sample    -
Experiment    -
Description    -
ceRNA target    -
Reference
Pubmed ID    28296235
Trait/Disease    Alzheimers Disease
Title    The circular RNA ciRS-7 promotes APP and BACE1 degradation in an NF-kapaB-dependent manner.
Authors    Shi Z, Chen T, Yao Q, Zheng L, Zhang Z, Wang J, Hu Z, Cui H, Han Y, Han X, Zhang K, Hong W.
Journal    FEBS J. 2017