RefCirc
a reference database for circRNAs validated by experiments

hsa_circ_0005986 Details
Basic Information
circRNA    hsa_circ_0005986
Alias    -
circBase ID    hsa_circ_0005986
Host gene    PRDM2
Species    homo sapiens
Peptide    -
Sequence  AACACTACTGAGCCTGTGGCGGCCACCGAGACCCTGGCTGAGGTACCCGAACATGTGCTGCGAGGACTTCCGGAGGAAGTGAGGCTTTTCCCTTCTGCTGTTGACAAGACCCGGATTGGTGTCTGGGCCACTAAACCAATTTTAAAAGGCAAAAAATTTGGGCCATTTGTTGGTGATAAGAAAAAAAGATCTCAGGTTAAGAATAATGTATACATGTGGGAGGTGTATTACCCAAATTTGGGATGGATGTGCATTGATGCCACTGATCCAGAGAAGGGAAACTGGCTGCGATATGTGAATTGGGCTTGCTCAGGAGAAGAGCAAAATTTATTCCCACTGGAAATCAACAGAGCCATTTACTATAAAACTTTAAAG
Expression
Description  Hsa_circ_0005986 was downregulated in HCC
Method    qRT-PCR
Sample    HCC tissues and para-tumorous tissues, LO2, HepG2, SMCC7721, and Huh7
Function
Description  Hsa_circ_0005986 regulates the cell cycle and cell proliferation
Method    loss of function
in vitro    HepG2 and Huh7
in vivo    -
Interaction
Target    miR-129-5p
Type    circRNA-miRNA
Sample    HepG2
Experiment    luciferase reporter assay
Description    Here, our study further verified the direct interaction between hsa_circ_0005986 and miR-129-5p via dual luciferase reporter assays.
ceRNA target    NOTCH1
Reference
Pubmed ID    28410211
Trait/Disease    Hepatocellular Carcinoma
Title    Hsa_circ_0005986 inhibits carcinogenesis by acting as a miR-129-5p sponge and is used as a novel biomarker for hepatocellular carcinoma.
Authors    Fu L, Chen Q, Yao T, Li T, Ying S, Hu Y, Guo J.
Journal    Oncotarget. 2017