RefCirc
a reference database for circRNAs validated by experiments
| circCNOT1 Details |
| Basic Information |
| circRNA | circCNOT1 |
| Alias | - |
| circBase ID | hsa_circ_0007079 |
| Host gene | CNOT1 |
| Species | homo sapiens |
| Peptide | - |
| Sequence | GAGTGTTTCTCAGGAGCTATCAGAAACTATCCTCACCATGGTAGCCAATTGCAGTAATGTTATGAATAAGGCCAGACAACCACCACCTGGAGTTATGCCAAAAGGACGTCCTCCTAGTGCTAGCAGCTTAGATGCCATTTCTCCTGTTCAG |
| Expression |
| Description | circRNA junctions were indeed amplified and verifying the presence of backsplice sites in these transcripts. |
| Method | qRT-PCR |
| Sample | HeLa |
| Reference |
| Pubmed ID | 28444238 |
| Trait/Disease | - |
| Title | High-purity circular RNA isolation method (RPAD) reveals vast collection of intronic circRNAs. |
| Authors | Panda AC, De S, Grammatikakis I, Munk R, Yang X, Piao Y, Dudekula DB, Abdelmohsen K, Gorospe M. |
| Journal | Nucleic Acids Res. 2017 |