RefCirc
a reference database for circRNAs validated by experiments
| circCNOT1 Details |
| Basic Information |
| circRNA   |   circCNOT1 |
| Alias   |   - |
| circBase ID   |   hsa_circ_0007079 |
| Host gene   |   CNOT1 |
| Species   |   homo sapiens |
| Peptide   |   - |
| Sequence   | GAGTGTTTCTCAGGAGCTATCAGAAACTATCCTCACCATGGTAGCCAATTGCAGTAATGTTATGAATAAGGCCAGACAACCACCACCTGGAGTTATGCCAAAAGGACGTCCTCCTAGTGCTAGCAGCTTAGATGCCATTTCTCCTGTTCAG |
| Expression |
| Description   | circRNA junctions were indeed amplified and verifying the presence of backsplice sites in these transcripts. |
| Method   |   qRT-PCR |
| Sample   |   HeLa |
| Function |
| Interaction |
| Reference |
| Pubmed ID   |   28444238 |
| Trait/Disease   |   - |
| Title   |   High-purity circular RNA isolation method (RPAD) reveals vast collection of intronic circRNAs. |
| Authors   |   Panda AC, De S, Grammatikakis I, Munk R, Yang X, Piao Y, Dudekula DB, Abdelmohsen K, Gorospe M. |
| Journal   |   Nucleic Acids Res. 2017 |