RefCirc
a reference database for circRNAs validated by experiments
circCNOT1 Details |
Basic Information |
circRNA   |   circCNOT1 |
Alias   |   - |
circBase ID   |   hsa_circ_0007079 |
Host gene   |   CNOT1 |
Species   |   homo sapiens |
Peptide   |   - |
Sequence   | GAGTGTTTCTCAGGAGCTATCAGAAACTATCCTCACCATGGTAGCCAATTGCAGTAATGTTATGAATAAGGCCAGACAACCACCACCTGGAGTTATGCCAAAAGGACGTCCTCCTAGTGCTAGCAGCTTAGATGCCATTTCTCCTGTTCAG |
Expression |
Description   | circRNA junctions were indeed amplified and verifying the presence of backsplice sites in these transcripts. |
Method   |   qRT-PCR |
Sample   |   HeLa |
Function |
Interaction |
Reference |
Pubmed ID   |   28444238 |
Trait/Disease   |   - |
Title   |   High-purity circular RNA isolation method (RPAD) reveals vast collection of intronic circRNAs. |
Authors   |   Panda AC, De S, Grammatikakis I, Munk R, Yang X, Piao Y, Dudekula DB, Abdelmohsen K, Gorospe M. |
Journal   |   Nucleic Acids Res. 2017 |