RefCirc
a reference database for circRNAs validated by experiments

circMTO1 Details
Basic Information
circRNA    circMTO1
Alias    hsa_circRNA_104135
circBase ID    hsa_circ_0007874
Host gene    MTO1
Species    homo sapiens
Peptide    -
Sequence  GTCAGATGTCATGTAATCCTTCCTTTGGTGGCATCGGAAAGGGACATTTAATGAGGGAAGTAGATGCCTTGGATGGCCTGTGTTCTCGCATCTGTGACCAGTCTGGTGTACATTATAAAGTATTAAACCGGCGTAAGGGACCAGCTGTGTGGGGTCTGAGAGCTCAGATTGATAGGAAACTCTATAAACAGAACATGCAGAAAGAAATCTTGAATACACCACTGCTTACTGTTCAGGAGGGAGCTGTAGAAGATCTTATTCTTACAGAACCAGAGCCTGAACACACTGGGAAATGCCGTGTCAGTGGGGTTGTTTTGG
Expression
Description  circMTO1 expression was consistently and significantly decreased in HCC tumor tissues as compared to that in matched nontumor liver tissues.Decreased circMTO1 expression is significantly correlated with poor prognosis of HCC patients.
Method    microarray, qRT-PCR
Sample    hepatocellular carcinoma tumor tissues, nontumor liver tissues
Function
Description  circMTO1 suppresses HCC progression by acting as the sponge of oncogenic miR-9 to promote p21 expression, suggesting that circMTO1 is a potential target in HCC treatment. The decrease of circMTO1 in HCC tissues may serve as a prognosis predictor for poor survival of patients.
Method    -
in vitro    HepG2, SMMC-7721, QGY-7701, SK-Hep1
in vivo    HCC-bearing male nude mice model SMMCLTNM
Interaction
Target    miR-9
Type    circRNA-miRNA
Sample    HepG2 cells
Experiment    RNA pull-down
Description    circMTO1 can bind miR-9 in the cytoplasm.
ceRNA target    p21
Reference
Pubmed ID    28520103
Trait/Disease    Hepatocellular Carcinoma
Title    Circular RNA circMTO1 acts as the sponge of microRNA-9 to suppress hepatocellular carcinoma progression.
Authors    Han D, Li J, Wang H, Su X, Hou J, Gu Y, Qian C, Lin Y, Liu X, Huang M, Li N, Zhou W, Yu Y, Cao X.
Journal    Hepatology. 2017