RefCirc
a reference database for circRNAs validated by experiments
| hsa_circ_0031979 Details |
| Basic Information |
| circRNA   |   hsa_circ_0031979 |
| Alias   |   - |
| circBase ID   |   hsa_circ_0031979 |
| Host gene   |   CDKN3 |
| Species   |   homo sapiens |
| Peptide   |   - |
| Sequence   | TAGCTGCTTGTCTCCTACTATACCTGTCTGACACAATATCACCAGAGCAAGCCATAGACAGCCTGCGAGACCTAAGAGGATCCGGGGCAATACAGACCATCAAG |
| Expression |
| Description   | downregulated in GC |
| Method   |   microarray, qRT-PCR |
| Sample   |   III stage gastric cancer and paired paracarcinoma tissue |
| Function |
| Interaction |
| Reference |
| Pubmed ID   |   28639908 |
| Trait/Disease   |   Gastric Cancer |
| Title   |   Circular RNAs play an important role in late-stage gastric cancer: Circular RNA expression profiles and bioinformatics analyses. |
| Authors   |   Fang Y, Ma M, Wang J, Liu X, Wang Y. |
| Journal   |   Tumour Biol. 2017 |