RefCirc
a reference database for circRNAs validated by experiments
hsa_circ_0031979 Details |
Basic Information |
circRNA   |   hsa_circ_0031979 |
Alias   |   - |
circBase ID   |   hsa_circ_0031979 |
Host gene   |   CDKN3 |
Species   |   homo sapiens |
Peptide   |   - |
Sequence   | TAGCTGCTTGTCTCCTACTATACCTGTCTGACACAATATCACCAGAGCAAGCCATAGACAGCCTGCGAGACCTAAGAGGATCCGGGGCAATACAGACCATCAAG |
Expression |
Description   | downregulated in GC |
Method   |   microarray, qRT-PCR |
Sample   |   III stage gastric cancer and paired paracarcinoma tissue |
Function |
Interaction |
Reference |
Pubmed ID   |   28639908 |
Trait/Disease   |   Gastric Cancer |
Title   |   Circular RNAs play an important role in late-stage gastric cancer: Circular RNA expression profiles and bioinformatics analyses. |
Authors   |   Fang Y, Ma M, Wang J, Liu X, Wang Y. |
Journal   |   Tumour Biol. 2017 |