RefCirc
a reference database for circRNAs validated by experiments
| hsa_circ_0023642 Details |
| Basic Information |
| circRNA   |   hsa_circ_0023642 |
| Alias   |   - |
| circBase ID   |   hsa_circ_0023642 |
| Host gene   |   UVRAG |
| Species   |   homo sapiens |
| Peptide   |   - |
| Sequence   | CAAAAGATGATGGAAGCATTGCTGTTGCCCTTGGTTATACTGCACATCTGGTCTCCATGATTTCCTTTTTCCTACAAGTGCCCCTCAGATATCCTATAATTCATAAGGGGTCTAGATCAACAATCAAAGACAATATCAATGACAAACTGACGGAAAAGGAGAGAGA |
| Expression |
| Description   | upregulated |
| Method   |   microarray, qRT-PCR |
| Sample   |   GC tissues and adjacent normal tissues |
| Function |
| Interaction |
| Reference |
| Pubmed ID   |   28737829 |
| Trait/Disease   |   Gastric Cancer |
| Title   |   Expression profile of circular RNAs in human gastric cancer tissues. |
| Authors   |   Huang YS, Jie N, Zou KJ, Weng Y. |
| Journal   |   Mol Med Rep. 2017 |