RefCirc
a reference database for circRNAs validated by experiments
hsa_circ_0000981 Details |
Basic Information |
circRNA   |   hsa_circ_0000981 |
Alias   |   hsa_circ_001506 |
circBase ID   |   hsa_circ_0000981 |
Host gene   |   LAPTM4A |
Species   |   homo sapiens |
Peptide   |   - |
Sequence   | GTAGTCTCCCACTATTTTATATCTTTGTTACTTCAAGTAAGACAATCTTAAATATGAGAGGACATCTAGAGATTGTGCTAAGATTGCGTCGTGATG |
Expression |
Description   | down-regulated in breast cancer |
Method   |   microarray, qRT-PCR |
Sample   |   cancer and adjacent noncancerous tissue |
Function |
Interaction |
Reference |
Pubmed ID   |   28744405 |
Trait/Disease   |   Breast Cancer |
Title   |   Circular RNA circ-ABCB10 promotes breast cancer proliferation and progression through sponging miR-1271. |
Authors   |   Liang HF, Zhang XZ, Liu BG, Jia GT, Li WL. |
Journal   |   Am J Cancer Res. 2017 |