RefCirc
a reference database for circRNAs validated by experiments
| hsa_circ_0000981 Details |
| Basic Information |
| circRNA   |   hsa_circ_0000981 |
| Alias   |   hsa_circ_001506 |
| circBase ID   |   hsa_circ_0000981 |
| Host gene   |   LAPTM4A |
| Species   |   homo sapiens |
| Peptide   |   - |
| Sequence   | GTAGTCTCCCACTATTTTATATCTTTGTTACTTCAAGTAAGACAATCTTAAATATGAGAGGACATCTAGAGATTGTGCTAAGATTGCGTCGTGATG |
| Expression |
| Description   | down-regulated in breast cancer |
| Method   |   microarray, qRT-PCR |
| Sample   |   cancer and adjacent noncancerous tissue |
| Function |
| Interaction |
| Reference |
| Pubmed ID   |   28744405 |
| Trait/Disease   |   Breast Cancer |
| Title   |   Circular RNA circ-ABCB10 promotes breast cancer proliferation and progression through sponging miR-1271. |
| Authors   |   Liang HF, Zhang XZ, Liu BG, Jia GT, Li WL. |
| Journal   |   Am J Cancer Res. 2017 |