RefCirc
a reference database for circRNAs validated by experiments
hsa_circ_0072765 Details |
Basic Information |
circRNA   |   hsa_circ_0072765 |
Alias   |   - |
circBase ID   |   hsa_circ_0072765 |
Host gene   |   CCNB1 |
Species   |   homo sapiens |
Peptide   |   - |
Sequence   | GTTGATGTCGAGCAACATACTTTGGCCAAATACCTGATGGAACTAACTATGTTGGACTATGACATGGTGCACTTTCCTCCTTCTCAAATTGCAGCAGGAGCTTTTTGCTTAGCACTGAAAATTCTGGATAATGGTGAATGG |
Expression |
Description   | significantly up-regulated in irradiated HSC compared with normal HSC. |
Method   |   qRT-PCR, microarray |
Sample   |   irradiated hepatic stellate cell (HSC) and normal HSC |
Function |
Interaction |
Reference |
Pubmed ID   |   28774651 |
Trait/Disease   |   Liver Fibrosis |
Title   |   Microarray profiling of circular RNAs and the potential regulatory role of hsa_circ_0071410 in the activated human hepatic stellate cell induced by irradiation. |
Authors   |   Chen Y, Yuan B, Wu Z, Dong Y, Zhang L, Zeng Z. |
Journal   |   Gene. 2017 |