RefCirc
a reference database for circRNAs validated by experiments
| hsa_circ_0072765 Details |
| Basic Information |
| circRNA   |   hsa_circ_0072765 |
| Alias   |   - |
| circBase ID   |   hsa_circ_0072765 |
| Host gene   |   CCNB1 |
| Species   |   homo sapiens |
| Peptide   |   - |
| Sequence   | GTTGATGTCGAGCAACATACTTTGGCCAAATACCTGATGGAACTAACTATGTTGGACTATGACATGGTGCACTTTCCTCCTTCTCAAATTGCAGCAGGAGCTTTTTGCTTAGCACTGAAAATTCTGGATAATGGTGAATGG |
| Expression |
| Description   | significantly up-regulated in irradiated HSC compared with normal HSC. |
| Method   |   qRT-PCR, microarray |
| Sample   |   irradiated hepatic stellate cell (HSC) and normal HSC |
| Function |
| Interaction |
| Reference |
| Pubmed ID   |   28774651 |
| Trait/Disease   |   Liver Fibrosis |
| Title   |   Microarray profiling of circular RNAs and the potential regulatory role of hsa_circ_0071410 in the activated human hepatic stellate cell induced by irradiation. |
| Authors   |   Chen Y, Yuan B, Wu Z, Dong Y, Zhang L, Zeng Z. |
| Journal   |   Gene. 2017 |