RefCirc
a reference database for circRNAs validated by experiments

cZNF609 Details
Basic Information
circRNA    cZNF609
Alias    hsa_circ_000193
circBase ID    hsa_circ_0000615
Host gene    ZNF609
Species    homo sapiens
Peptide    -
Sequence  CAATGATGTTGTCCACTGGGCATGTACTGACCAATGTGGCAGGTCTGAGAACATAGCTGAAGCTGAAAATAGGAAAGCTGGGGGCAAGGAAGAGCCTTGAATCTTGAGGTGGGACGTTGACTCTAAGATGTCCTTGAGCAGTGGAGCCTCCGGAGGGAAAGGAGTGGATGCAAACCCGGTTGAGACATACGACAGTGGGGATGAATGGGACATTGGAGTAGGGAATCTCATCATTGACCTGGACGCCGATCTGGAAAAGGACCAGCAGAAACTGGAAATGTCAGGCTCAAAGGAGGTGGGGATACCGGCTCCCAATGCTGTGGCCACACTACCAGACAACATCAAGTTTGTGACCCCAGTGCCAGGTCCTCAAGGGAAGGAAGGCAAATCAAAATCCAAAAGGAGTAAGAGTGGCAAAGACACTAGCAAACCCACTCCAGGGACTTCCCTGTTCACTCCAAGTGAGGGGGCAGCTAGCAAGAAAGAGGTGCAGGGGCGCTCAGGAGATGGTGCCAATGCTGGAGGCCTGGTTGCTGCTATTGCTCCCAAGGGCTCAGAGAAGGCGGCTAAGGCATCCCGCAGTGTAGCCGGTTCCAAAAAGGAGAAGGAGAACAGCTCATCTAAGAGCAAGAAGGAGAGAAGCGAAGGAGTGGGGACTTGTTCAGAAAAGGATCCTGGGGTCCTCCAGCCAGTTCCCTTGGGAGGACGGGGTGGTCAGTATGATGGAAGTGCAGGGGTGGATACAGGAGCTGTGGAGCCACTTGGGAGTATAGCTATTGAGCCTGGGGCAGCGCTCAATCCTTTGGGAACTAAACCGGAGCCAGAGGAAGGGGAGAATGAGTGTCGCCTGCTAAAGAAAGTCAAGTCTGAAAAG
Expression
Description  cZNF609 was expressed in several endothelial cells derived from different human vascular beds, including EA.hy.926 cells, HMVECs, HUVECs, RF/6A cells, and HCAECs. qRT-PCRs and fluorescence in situ hybridization (FISH) assays revealed that cZNF609 was mainly expressed in the cytoplasm of HUVECs. HUVECs were exposed to high glucose medium to mimic diabetic condition. High glucose increased cZNF609 expression in a time-dependant manner. cZNF609 expression in diabetic retinas was significantly higher than that in non-diabetic controls. In the mouse model of oxygen-induced retinopathy (OIR), retinal cZNF609 expression was significantly down-regulated at the vaso-obliteration stage (P7-P12), whereas up-regulated at the neovascularization stage (P12-P17).
Method    qRT-PCR, FISH
Sample    EA.hy.926 cells, HMVECs, HUVECs, RF/6A cells, and HCAECs. diabetic retinas
Function
Description  cZNF609 silencing decreased retinal vessel loss and suppressed pathological angiogenesis in vivo. cZNF609 silencing increased endothelial cell migration and tube formation, and protected endothelial cell against oxidative stress and hypoxia stress in vitro. By contrast, transgenic overexpression of cZNF609 showed an opposite effects. cZNF609 acted as an endogenous miR-615-5p sponge to sequester and inhibit miR-615-5p activity, which led to increased MEF2A expression. MEF2A overexpression could rescue cZNF609 silencing-mediated effects on endothelial cell migration, tube formation, and apoptosis. Moreover, dysregulated cZNF609 expression was detected in the clinical samples of the patients with diabetes, hypertension, and coronary artery disease. Intervention of cZNF609 expression is promising therapy for vascular dysfunction.
Method    loss of function, gain of function
in vitro    endothelial cell
in vivo    Diabetic C57BL/6 mice
Interaction
Target    miR-615-5p
Type    circRNA-miRNA
Sample    HUVECs
Experiment    luciferase reporter assay, RIP
Description    cZNF609 serves as a binding platform for Ago2 and miR-615-5p, and may function as a miRNA sponge.
ceRNA target    MEF2A
Reference
Pubmed ID    28824721
Trait/Disease    Vascular Endothelial Dysfunction
Title    Silencing Of Circular RNA-ZNF609 Ameliorates Vascular Endothelial Dysfunction.
Authors    Liu C, Yao MD, Li CP, Shan K, Yang H, Wang JJ, Liu B, Li XM, Yao J, Jiang Q, Yan B.
Journal    Theranostics. 2017