RefCirc
a reference database for circRNAs validated by experiments

circHIPK3 Details
Basic Information
circRNA    circHIPK3
Alias    hsa_circ_000016
circBase ID    hsa_circ_0000284
Host gene    HIPK3
Species    homo sapiens
Peptide    -
Sequence  GTATGGCCTCACAAGTCTTGGTCTACCCACCATATGTTTATCAAACTCAGTCAAGTGCCTTTTGTAGTGTGAAGAAACTCAAAGTAGAGCCAAGCAGTTGTGTATTCCAGGAAAGAAACTATCCACGGACCTATGTGAATGGTAGAAACTTTGGAAATTCTCATCCTCCCACTAAGGGTAGTGCTTTTCAGACAAAGATACCATTTAATAGACCTCGAGGACACAACTTTTCATTGCAGACAAGTGCTGTTGTTTTGAAAAACACTGCAGGTGCTACAAAGGTCATAGCAGCTCAGGCACAGCAAGCTCACGTGCAGGCACCTCAGATTGGGGCGTGGCGAAACAGATTGCATTTCCTAGAAGGCCCCCAGCGATGTGGATTGAAGCGCAAGAGTGAGGAGTTGGATAATCATAGCAGCGCAATGCAGATTGTCGATGAATTGTCCATACTTCCTGCAATGTTGCAAACCAACATGGGAAATCCAGTGACAGTTGTGACAGCTACCACAGGATCAAAACAGAATTGTACCACTGGAGAAGGTGACTATCAGTTAGTACAGCATGAAGTCTTATGCTCCATGAAAAATACTTACGAAGTCCTTGATTTTCTTGGTCGAGGCACGTTTGGCCAGGTAGTTAAATGCTGGAAAAGAGGGACAAATGAAATTGTAGCAATCAAAATTTTGAAGAATCATCCTTCTTATGCCCGTCAAGGTCAAATAGAAGTGAGCATATTAGCAAGGCTCAGTACTGAAAATGCTGATGAATATAACTTTGTACGAGCTTATGAATGCTTTCAGCACCGTAACCATACTTGTTTAGTCTTTGAGATGCTGGAACAAAACTTGTATGACTTTCTGAAACAAAATAAATTTAGTCCCCTGCCACTAAAAGTGATTCGGCCCATTCTTCAACAAGTGGCCACTGCACTGAAAAAATTGAAAAGTCTTGGTTTAATTCATGCTGATCTCAAGCCAGAGAATATTATGTTGGTGGATCCTGTTCGGCAGCCTTACAGGGTTAAAGTAATAGACTTTGGGTCGGCCAGTCATGTATCAAAGACTGTTTGTTCAACATATCTACAATCTCGGTACTACAG
Expression
Description  circHIPK3 expression was significantly up-regulated in diabetic retinas and retinal endothelial cells following stressors related to diabetes.
Method    qRT-PCR, sanger sequencing, northern blots
Sample    diabetic retinas and retinal endothelial cells
Function
Description  circHIPK3 silencing or over-expressing circHIPK3 changed retinal endothelial cell viability, proliferation, migration, and tube formation in vitro. circHIPK3 silencing in vivo alleviated retinal vascular dysfunction, as shown by decreased retinal acellular capillaries, vascular leakage, and inflammation. circHIPK3 acted as an endogenous miR-30a-3p sponge to sequester and inhibit miR-30a-3p activity, which led to increased VEGFC, FZD4, and WNT2 expression. Ectopic expression of miR-30a-3p mimicked the effect of circHIPK3 silencing on vascular endothelial phenotypes in vivo and in vitro.
Method    loss of function, gain of function
in vitro    human retinal vascular endothelial cells
in vivo    diabetic mice, PBS-injected mice
Interaction
Target    miR-30a-3p
Type    circRNA-miRNA
Sample    human retinal vascular endothelial cells
Experiment    luciferase reporter assay, AGO2 RIP, RNA pull-down, RNA FISH
Description    Three miRNAs (miR-30a-3p, miR-30d-3p, and miR-30e-3p) significantly reduced the activity of LUC-circHIPK3 by at least 37%. RNA-FISH assays revealed a large degree of overlap between circHIPK3 and miR-30a-3p, miR-30d-3p, or miR-30e-3p. Furthermore, using a biotin-coupled miR-30a-3p, miR-30d-3p, and miR-30e-3p, we observed greater enrichment of circHIPK3 in miR-30-captured fraction compared to the negative control, biotinylated miR-335. These results suggest that circHIPK3 serves as a binding platform for Ago2 and miRNAs, and may act as a miRNA sponge.
ceRNA target    VEGFC, FZD4, and WNT2
Reference
Pubmed ID    28860123
Trait/Disease    Diabetes Mellitus
Title    Circular Noncoding RNA HIPK3 Mediates Retinal Vascular Dysfunction in Diabetes Mellitus.
Authors    Shan K, Liu C, Liu BH, Chen X, Dong R, Liu X, Zhang YY, Liu B, Zhang SJ, Wang JJ, Zhang SH, Wu JH, Zhao C, Yan B.
Journal    Circulation. 2017