RefCirc
a reference database for circRNAs validated by experiments
hsa_circ_0000181 Details |
Basic Information |
circRNA   |   hsa_circ_0000181 |
Alias   |   hsa_circ_002099 |
circBase ID   |   hsa_circ_0000181 |
Host gene   |   TATDN3 |
Species   |   homo sapiens |
Peptide   |   - |
Sequence   | GTTGGACTAGATTTCTCCCCCAGATTTGCTGGCACTGGTGAACAGAAGGAAGAGCAAAGACAAGTCCTAATCAGACAGATCCAGTTAGCCAAAAGACTAAATTTGCCTGTAAATGTGCACTCACGCTCTGCTGGAAGACCTACCATCAACCTTTTACAAGAGCAAGGTGCTGAGAAGGTACTGCTGCATGCATTTGATGGTCGGCCATCTGTAGCCATGGAAGGAGTAAGAGCTGGGTACTTCTTCTCAATTCCCCCTTCTATCATAAGAAGTGGACAG |
Expression |
Description   | Hsa_circ_0000181 expression was downregulated in gastric cancer tissues and plasma of patients with gastric cancer. |
Method   |   qRT-PCR |
Sample   |   gastric cancer and paired adjacent non-tumorous tissues and patients fasting peripheral plasma |
Function |
Interaction |
Reference |
Pubmed ID   |   28940688 |
Trait/Disease   |   Gastric Cancer |
Title   |   Clinical values of circular RNA 0000181 in the screening of gastric cancer. |
Authors   |   Zhao Q, Chen S, Li T, Xiao B, Zhang X. |
Journal   |   J Clin Lab Anal. 2017 |