RefCirc
a reference database for circRNAs validated by experiments

hsa_circ_0003575 Details
Basic Information
circRNA    hsa_circ_0003575
Alias    -
circBase ID    hsa_circ_0003575
Host gene    CHMP5
Species    homo sapiens
Peptide    -
Sequence  GTTGATGCTATGAAACTGGGAGTAAAGGAAATGAAGAAGGCATACAAGCAAGTGAAGATCGACCAGATTGAGGATTTACAAGACCAGCTAGAGGATATGATGGAAGATGCAAATGAAATCCAAGAAGCACTGAGTCGCAGTTATGGCACCCCAGAACTGGATGAAGATGATTTAGAAGCAGAGTTGGATGCACTAGGTGATGAGCTTCTGGCTGATGAAGACAGTTCTTATTTGGATGAGGCAGCATCTGCACCTGCAATTCCAGAAGGTGTTCCCACTGATACAAAAAACAAG
Expression
Description  Significantly up-regulated in HUVECs treated with oxLDL compared to HUVECs controls.
Method    microarray, qRT-PCR
Sample    Human umbilical vein endothelial cells
Function
Description  Loss-of-function experiments indicated that hsa_-circ_0003575 silencing promoted the proliferation and angiogenesis ability of HUVECs.
Method    loss of function
in vitro    Human umbilical vein endothelial cells
in vivo    -
Interaction
Target    miR-199-3p, miR-9-5p, miR-377-3p and miR-141-3p
Type    circRNA-miRNA
Sample    Human umbilical vein endothelial cells
Experiment    predicted
Description    Bioinformatics online tools (starBase, circRase,TargetScan, miRBase) predicted that hsa_circ_0003575 had potential target miRNAs, including miR-199-3p, miR-9-5p, miR-377-3p and miR-141-3p.
ceRNA target    -
Reference
Pubmed ID    28946214
Trait/Disease    Atherosclerosis
Title    Circular RNA hsa_circ_0003575 regulates oxLDL induced vascular endothelial cells proliferation and angiogenesis.
Authors    Li CY, Ma L, Yu B.
Journal    Biomed Pharmacother. 2017