RefCirc
a reference database for circRNAs validated by experiments

circCORO1C Details
Basic Information
circRNA    circCORO1C
Alias    hsa_circ_002167
circBase ID    hsa_circ_0000437
Host gene    CORO1C
Species    homo sapiens
Peptide    -
Sequence  AAAAATATGCAGGAACCAATTGCTCTTCATGAGATGGACACTAGCAATGGGGTGTTGCTGCCTTTCTATGACCCTGACACCAGCATCATTTACTTATGTGGAAAGGGTGACAGCAGTATTCGCTATTTTGAGATCACGGATGAATCCCCGTACGTCCACTACCTCAACACATTCAGCAGCAAGGAGCCTCAGAGAGGGATGGGTTACATGCCCAAGAGGGGACTTGATGTTAACAAATGTGAGATTGCCAG
Expression
Description  Eenriched in hESCs (>0.1% of GAPDH levels). Downregulated in Ebs, upregulated in induced pluripotent stem cells (iPSCs) as compared with the parental fibroblasts.
Method    qRT-PCR
Sample    Human embryonic stem cells, induced pluripotent stem cells
Function
Description  Disrupting circBIRC6 or circCORO1C impairs hESC pluripotency. Expressing circBIRC6 or circCORO1C retains hESC pluripotency. Expressing circBIRC6 or circCORO1C promotes reprogramming.
Method    loss of function, gain of function
in vitro    Human embryonic stem cells
in vivo    -
Interaction
Target    -
Type    -
Sample    -
Experiment    -
Description    -
ceRNA target    -
Reference
Pubmed ID    29074849
Trait/Disease    -
Title    The circular RNA circBIRC6 participates in the molecular circuitry controlling human pluripotency.
Authors    Yu CY, Li TC, Wu YY, Yeh CH, Chiang W, Chuang CY, Kuo HC.
Journal    Nat Commun. 2017