RefCirc
a reference database for circRNAs validated by experiments
| circCORO1C Details |
| Basic Information |
| circRNA   |   circCORO1C |
| Alias   |   hsa_circ_002167 |
| circBase ID   |   hsa_circ_0000437 |
| Host gene   |   CORO1C |
| Species   |   homo sapiens |
| Peptide   |   - |
| Sequence   | AAAAATATGCAGGAACCAATTGCTCTTCATGAGATGGACACTAGCAATGGGGTGTTGCTGCCTTTCTATGACCCTGACACCAGCATCATTTACTTATGTGGAAAGGGTGACAGCAGTATTCGCTATTTTGAGATCACGGATGAATCCCCGTACGTCCACTACCTCAACACATTCAGCAGCAAGGAGCCTCAGAGAGGGATGGGTTACATGCCCAAGAGGGGACTTGATGTTAACAAATGTGAGATTGCCAG |
| Expression |
| Description   | Eenriched in hESCs (>0.1% of GAPDH levels). Downregulated in Ebs, upregulated in induced pluripotent stem cells (iPSCs) as compared with the parental fibroblasts. |
| Method   |   qRT-PCR |
| Sample   |   Human embryonic stem cells, induced pluripotent stem cells |
| Function |
| Interaction |
| Reference |
| Pubmed ID   |   29074849 |
| Trait/Disease   |   - |
| Title   |   The circular RNA circBIRC6 participates in the molecular circuitry controlling human pluripotency. |
| Authors   |   Yu CY, Li TC, Wu YY, Yeh CH, Chiang W, Chuang CY, Kuo HC. |
| Journal   |   Nat Commun. 2017 |