RefCirc
a reference database for circRNAs validated by experiments
| hsa_circ_0061276 Details |
| Basic Information |
| circRNA   |   hsa_circ_0061276 |
| Alias   |   - |
| circBase ID   |   hsa_circ_0061276 |
| Host gene   |   NRIP1 |
| Species   |   homo sapiens |
| Peptide   |   - |
| Sequence   | GAAGTGTTTGGATTGTGAGCTATTTCAGAACTGTTCTCAGGACTCATTATTTTAACATTTGGGAGAAACACAGCCAGAAG |
| Expression |
| Description   | down |
| Method   |   microarray, RT-ddPCR |
| Sample   |   gastric cancer tissues and their adjacent non-tumorous tissues, and gastric cancer patients plasma and healthy controls, BGC-823, MGC-803, SGC-7901 and GES-1 |
| Function |
| Interaction |
| Reference |
| Pubmed ID   |   29098316 |
| Trait/Disease   |   Gastric Cancer |
| Title   |   Plasma circular RNA profiling of patients with gastric cancer and their droplet digital RT-PCR detection. |
| Authors   |   Li T, Shao Y, Fu L, Xie Y, Zhu L, Sun W, Yu R, Xiao B, Guo J. |
| Journal   |   J Mol Med (Berl). 2018 |