RefCirc
a reference database for circRNAs validated by experiments
hsa_circ_0061276 Details |
Basic Information |
circRNA   |   hsa_circ_0061276 |
Alias   |   - |
circBase ID   |   hsa_circ_0061276 |
Host gene   |   NRIP1 |
Species   |   homo sapiens |
Peptide   |   - |
Sequence   | GAAGTGTTTGGATTGTGAGCTATTTCAGAACTGTTCTCAGGACTCATTATTTTAACATTTGGGAGAAACACAGCCAGAAG |
Expression |
Description   | down |
Method   |   microarray, RT-ddPCR |
Sample   |   gastric cancer tissues and their adjacent non-tumorous tissues, and gastric cancer patients plasma and healthy controls, BGC-823, MGC-803, SGC-7901 and GES-1 |
Function |
Interaction |
Reference |
Pubmed ID   |   29098316 |
Trait/Disease   |   Gastric Cancer |
Title   |   Plasma circular RNA profiling of patients with gastric cancer and their droplet digital RT-PCR detection. |
Authors   |   Li T, Shao Y, Fu L, Xie Y, Zhu L, Sun W, Yu R, Xiao B, Guo J. |
Journal   |   J Mol Med (Berl). 2018 |