RefCirc
a reference database for circRNAs validated by experiments
| KIRKOS-73 Details |
| Basic Information |
| circRNA   |   KIRKOS-73 |
| Alias   |   - |
| circBase ID   |   hsa_circ_0040573 |
| Host gene   |   WWOX |
| Species   |   homo sapiens |
| Peptide   |   - |
| Sequence   | GCCTCTTCATGTGCTTGTGTGCAACGCAGCAACTTTTGCTCTACCCTGGAGTCTCACCAAAGATGGCCTGGAGACCACCTTTCAAGTGAATCATCTGGGGCACTTCTACCTTGTCCAGCTCCTCCAGGATGTTTTGTGCCGCTCAGCTCCTGCCCGTGTCATTGTGGTCTCCTCAGAGTCCCATCGATTTACAGATATTAACGACTCCTTGGGAAAACTGGACTTCAGTCGCCTCTCTCCAACAAAAAACGACTATTGGGCGATGCTGGCTTATAACAGGTCCAAGCTCTGCAACATCCTCTTCTCCAACGAGCTGCACCGTCGCCTCTCCCCACGCGGGGTCACGTCGAACGCAGTGCATCCTGGAAATATGATGTACTCCAACATTCATCGCAGCTGGTGGGTGTACACACTGCTGTTTACCTTGGCGAGGCCTTTCACCAAGTCCATG |
| Expression |
| Description   | KIRKOS-73 was found to be significantly down-regulated in HUVEC 4 and 24 hr post low dose irradiation. This circRNA was down-regulated in the neuroblastoma cell line SHEP 24 hr post low (0.58 +/-0.12 fold, p = 0.04) and medium (0.67 +/- 0.2 fold, p =0.01) dose exposure. In contrast, KIRKOS-73 showed a significantly elevated expression profile in the osteosarcoma cell line U2OS by 24 hr post 0.25 Gy in comparison to sham-irradiated control conditions (2.95 +/- 0.29 fold increase, p = 0.01). This circRNA was also upregulated in this cell line post 4 hr (1.09 +/- 0.11 fold increase, p = 0.01) and 24 hr (1.3 +/- 0.03 fold increase, p = 0.0008) after 2.5 Gy exposure compared to controls. Exosomes were extracted from SHEP and U2OS 24 hr following 2.5 Gy, 0.25 Gy or sham irradiation. KIRKOS-73 was found to be significantly upregulated in exosomes post 2.5 Gy in U2OS in comparison to their individual sham irradiated controls (p = 0.0008 and p = 0.011, respectively). In contrast, it was significantly down regulated at this time point post 2.5 Gy in exosomes isolated from SHEP in comparison to sham irradiated controls (p = 0.002 and p = 0.000057, respectively). |
| Method   |   microarray, qRT-PCR |
| Sample   |   Human umbilical vein endothelial cells, neuroblastoma cell line SHEP, osteosarcoma cell line U2OS, |
| Function |
| Interaction |
| Reference |
| Pubmed ID   |   29108237 |
| Trait/Disease   |   - |
| Title   |   The circRNA interactome-innovative hallmarks of the intra- and extracellular radiation response. |
| Authors   |   OLeary VB, Smida J, Matjanovski M, Brockhaus C, Winkler K, Moertl S, Ovsepian SV, Atkinson MJ. |
| Journal   |   Oncotarget. 2017 |