RefCirc
a reference database for circRNAs validated by experiments

KIRKOS-73 Details

Basic Information
circRNA    KIRKOS-73
Alias    -
circBase ID    hsa_circ_0040573
Host gene    WWOX
Species    homo sapiens
Peptide    -
Sequence  GCCTCTTCATGTGCTTGTGTGCAACGCAGCAACTTTTGCTCTACCCTGGAGTCTCACCAAAGATGGCCTGGAGACCACCTTTCAAGTGAATCATCTGGGGCACTTCTACCTTGTCCAGCTCCTCCAGGATGTTTTGTGCCGCTCAGCTCCTGCCCGTGTCATTGTGGTCTCCTCAGAGTCCCATCGATTTACAGATATTAACGACTCCTTGGGAAAACTGGACTTCAGTCGCCTCTCTCCAACAAAAAACGACTATTGGGCGATGCTGGCTTATAACAGGTCCAAGCTCTGCAACATCCTCTTCTCCAACGAGCTGCACCGTCGCCTCTCCCCACGCGGGGTCACGTCGAACGCAGTGCATCCTGGAAATATGATGTACTCCAACATTCATCGCAGCTGGTGGGTGTACACACTGCTGTTTACCTTGGCGAGGCCTTTCACCAAGTCCATG

Expression
Description  KIRKOS-73 was found to be significantly down-regulated in HUVEC 4 and 24 hr post low dose irradiation. This circRNA was down-regulated in the neuroblastoma cell line SHEP 24 hr post low (0.58 +/-0.12 fold, p = 0.04) and medium (0.67 +/- 0.2 fold, p =0.01) dose exposure. In contrast, KIRKOS-73 showed a significantly elevated expression profile in the osteosarcoma cell line U2OS by 24 hr post 0.25 Gy in comparison to sham-irradiated control conditions (2.95 +/- 0.29 fold increase, p = 0.01). This circRNA was also upregulated in this cell line post 4 hr (1.09 +/- 0.11 fold increase, p = 0.01) and 24 hr (1.3 +/- 0.03 fold increase, p = 0.0008) after 2.5 Gy exposure compared to controls. Exosomes were extracted from SHEP and U2OS 24 hr following 2.5 Gy, 0.25 Gy or sham irradiation. KIRKOS-73 was found to be significantly upregulated in exosomes post 2.5 Gy in U2OS in comparison to their individual sham irradiated controls (p = 0.0008 and p = 0.011, respectively). In contrast, it was significantly down regulated at this time point post 2.5 Gy in exosomes isolated from SHEP in comparison to sham irradiated controls (p = 0.002 and p = 0.000057, respectively).
Method    microarray, qRT-PCR
Sample    Human umbilical vein endothelial cells, neuroblastoma cell line SHEP, osteosarcoma cell line U2OS,

Function
Description  -
Method    -
in vitro    -
in vivo    -

Interaction
Target    QKI-5
Type    circRNA-protein
Sample    U2OS
Experiment    RNA pull-down, qPCR
Description    QPCR amplification confirmed the presence of the KIRKOS-73 associating with QKI-5 in U2OS.
ceRNA target    -

Reference
Pubmed ID    29108237
Trait/Disease    -
Title    The circRNA interactome-innovative hallmarks of the intra- and extracellular radiation response.
Authors    OLeary VB, Smida J, Matjanovski M, Brockhaus C, Winkler K, Moertl S, Ovsepian SV, Atkinson MJ.
Journal    Oncotarget. 2017