RefCirc
a reference database for circRNAs validated by experiments
CircARSP91 Details |
Basic Information |
circRNA   |   CircARSP91 |
Alias   |   - |
circBase ID   |   hsa_circ_0085154 |
Host gene   |   PABPC1 |
Species   |   homo sapiens |
Peptide   |   - |
Sequence   | ACTCAGAACCGTGCTGCATACTATCCTCCTAGCCAAATTGCTCAACTAAGACCAAGTCCTCGCTGGACTGCTCAGGGTGCCAGACCTCATC |
Expression |
Description   | downregulated by AR in an ADAR1-dependent manner |
Method   |   microarray, qRT-PCR |
Sample   |   MHCC-97h, LM3 and LO2 cells |
Function |
Interaction |
Reference |
Pubmed ID   |   29144509 |
Trait/Disease   |   Hepatocellular Carcinoma |
Title   |   Circular RNA expression is suppressed by androgen receptor (AR)-regulated adenosine deaminase that acts on RNA (ADAR1) in human hepatocellular carcinoma. |
Authors   |   Shi L, Yan P, Liang Y, Sun Y, Shen J, Zhou S, Lin H, Liang X, Cai X. |
Journal   |   Cell Death Dis. 2017 |