RefCirc
a reference database for circRNAs validated by experiments
| CircARSP91 Details |
| Basic Information |
| circRNA   |   CircARSP91 |
| Alias   |   - |
| circBase ID   |   hsa_circ_0085154 |
| Host gene   |   PABPC1 |
| Species   |   homo sapiens |
| Peptide   |   - |
| Sequence   | ACTCAGAACCGTGCTGCATACTATCCTCCTAGCCAAATTGCTCAACTAAGACCAAGTCCTCGCTGGACTGCTCAGGGTGCCAGACCTCATC |
| Expression |
| Description   | downregulated by AR in an ADAR1-dependent manner |
| Method   |   microarray, qRT-PCR |
| Sample   |   MHCC-97h, LM3 and LO2 cells |
| Function |
| Interaction |
| Reference |
| Pubmed ID   |   29144509 |
| Trait/Disease   |   Hepatocellular Carcinoma |
| Title   |   Circular RNA expression is suppressed by androgen receptor (AR)-regulated adenosine deaminase that acts on RNA (ADAR1) in human hepatocellular carcinoma. |
| Authors   |   Shi L, Yan P, Liang Y, Sun Y, Shen J, Zhou S, Lin H, Liang X, Cai X. |
| Journal   |   Cell Death Dis. 2017 |