RefCirc
a reference database for circRNAs validated by experiments
| hsa_circ_0082314 Details |
| Basic Information |
| circRNA   |   hsa_circ_0082314 |
| Alias   |   - |
| circBase ID   |   hsa_circ_0082314 |
| Host gene   |   NRF1 |
| Species   |   homo sapiens |
| Peptide   |   - |
| Sequence   | CGAAGCTGCCGCCCATGCTGTCGCCACCCTGGCTGAGGCCACCTTACAAGGTGGGGGACAGATCGTCTTGTCTGGGGAAACCGCAGCAGCCGTCGGAGCACTTACTGGAGTCCAAGATGCTAATG |
| Expression |
| Description   | upregulated more than fivefold as revealed by circRNA microarray after AR knocking down in MHCC-106h cells |
| Method   |   microarray, qRT-PCR |
| Sample   |   MHCC-97h, LM3 and LO12 cells |
| Function |
| Interaction |
| Reference |
| Pubmed ID   |   29144509 |
| Trait/Disease   |   Hepatocellular Carcinoma |
| Title   |   Circular RNA expression is suppressed by androgen receptor (AR)-regulated adenosine deaminase that acts on RNA (ADAR1) in human hepatocellular carcinoma. |
| Authors   |   Shi L, Yan P, Liang Y, Sun Y, Shen J, Zhou S, Lin H, Liang X, Cai X. |
| Journal   |   Cell Death Dis. 2017 |