RefCirc
a reference database for circRNAs validated by experiments

circRNA PDS5B Details
Basic Information
circRNA    circRNA PDS5B
Alias    -
circBase ID    hsa_circ_0004494
Host gene    PDS5B
Species    homo sapiens
Peptide    -
Sequence  AGCCTTGCTTCCTGTTTTACATCACAAATCTAAAAAAGGACCCCCCCGTCAAGCCAAATATGCCATTCATTGTATCCATGCGATATTTTCTAGTAAAGAGACCCAGTTTGCACAGATATTTGAGCCTCTGCATAAGAGCCTAGATCCAAGCAACCTGGAACATCTCATAACACCATTGGTTACTATTGGTCATATTGCTCTCCTTGCACCTGATCAATTTGCTGCTCCTTTGAAATCTTTGGTAGCTACTTTCATTGTGAAAGATCTTCTCATGAATGATCGG
Expression
Description  This circRNA with top H score and high/medium expression of the host transcript was (1) resistant to RNase R and (2) had the predicted head-to-tail junctions, as validated by Sanger sequencing, suggesting that the circRNA exists in circularized form in HEK293 cells.
Method    qRT-PCR, sanger sequencing
Sample    HEK293 cells
Function
Description  -
Method    -
in vitro    -
in vivo    -
Interaction
Target    -
Type    -
Sample    -
Experiment    -
Description    -
ceRNA target    -
Reference
Pubmed ID    25558066
Trait/Disease    -
Title    Analysis of intron sequences reveals hallmarks of circular RNA biogenesis in animals.
Authors    Ivanov A, Memczak S, Wyler E, Torti F, Porath HT, Orejuela MR, Piechotta M, Levanon EY, Landthaler M, Dieterich C, Rajewsky N.
Journal    Cell Rep. 2015