RefCirc
a reference database for circRNAs validated by experiments

circHECW2 Details
Basic Information
circRNA    circHECW2
Alias    -
circBase ID    hsa_circ_0002150
Host gene    HECW2
Species    homo sapiens
Peptide    -
Sequence  GCATTCTTTGTGGACCACAACTCCCGCACCACCACTTTCATTGATCCCCGGCTCCCACTTCAGAGCAGTAGACCCACAAGTGCGCTGGTTCATCGGCAACACCTGACAAGGCAACGCAGCCACAGTGCGGGTGAGGTAGGAGAAGATTCTCGACATGCAGGACCACCAGTTCTTCCCAGGCCATCCAGTACATTCAATACAGTCAGTAGGCCACAGTACCAGGACATGGTTCCAGTGGCTTACAATGACAAGATTGTTGCATTTCTACGTCAACCCAATATCTTTGAAATTCTACAGGAGCGTCAACCTGATCTTACCAGGAATCACTCACTCAG
Expression
Description  The treatment of HBMECs with Meth or LPS significantly increased the circHECW2 expression in HBMECs. This finding was further confirmed in LPS-treated mice as there was an increased expression of circHecw2 in the hippocampus.
Method    qRT-PCR
Sample    human brain microvascular endothelial cells, mice hippocampus
Function
Description  circHECW2 regulated the EndoMT by directly binding to MIR30D, a significantly downregulated miRNA from miRNA profiling, which subsequently caused an increased expression of ATG5.
Method    loss of function
in vitro    human brain microvascular endothelial cells
in vivo    the hippocampus of C57BL/6J mice
Interaction
Target    miR-30d-5p
Type    circRNA-miRNA
Sample    human brain microvascular endothelial cells
Experiment    RNA pull-down
Description    An enrichment of circHECW2 in the MIR30D-captured fraction compared with that observed following the introduction of mutations that disrupt base paring between circHECW2 and MIR30D. By applying a biotin-labeled specific probe, MIR30D was pulled down by circHECW2.
ceRNA target    ATG5
Reference
Pubmed ID    29260931
Trait/Disease    -
Title    Engagement of circular RNA HECW2 in the nonautophagic role of ATG5 implicated in the endothelial-mesenchymal transition.
Authors    Yang L, Han B, Zhang Y, Bai Y, Chao J, Hu G, Yao H.
Journal    Autophagy. 2018