RefCirc
a reference database for circRNAs validated by experiments

hsa_circ_0046701 Details
Basic Information
circRNA    hsa_circ_0046701
Alias    -
circBase ID    hsa_circ_0046701
Host gene    YES1
Species    homo sapiens
Peptide    -
Sequence  GTGGTGTTACTATATTTGTGGCCTTATATGATTATGAAGCTAGAACTACAGAAGACCTTTCATTTAAGAAGGGTGAAAGATTTCAAATAATTAACAATACGGAAGGAGATTGGTGGGAAGCAAGATCAATCGCTACAGGAAAGAATGGTTATATCCCGAGCAATTATGTAGCGCCTGCAGATTCCATTCAGGCAGAAGAATGGTATTTTGGCAAAATGGGGAGAAAAGATGCTGAAAGATTACTTTTGAATCCTGGAAATCAACGAGGTATTTTCTTAGTAAGAGAGAGTGAAACAACTAAAGGTGCTTATTCCCTTTCTATTCGTGATTGGGATGAGATAAGGGGTGACAATGTGAAACACTACAAAATTAGGAAACTTGACAATGGTGGATACTATATCACAACCAGAGCACAATTTGATACTCTGCAGAAATTGGTGAAACACTACACAG
Expression
Description  significantly upregulated in glioma tissues and cell lines
Method    qRT-PCR
Sample    Normal human astrocytes (NHAs) and glioma cell lines (U251, U373, and SHG44), glioma tissues and corresponding adjacent normal tissues
Function
Description  Knockdown of hsa_circ_0046701 significantly decreased the cell viability, as assessed by the MTT assay, markedly reduced the number of colonies in the colony formation assay, and remarkably attenuated the invasive ability of the cells in the Transwell assay.
Method    loss of function
in vitro    U251 and U373
in vivo    -
Interaction
Target    miR-142-3p
Type    circRNA-miRNA
Sample    HEK-293T
Experiment    luciferase reporter assay
Description    The results showed that transfection of miR-142-3p mimics significantly attenuated the activity of the luciferase reporter containing wild-type (WT) hsa_circ_0046701 compared with the miR-142-3p mimics control.
ceRNA target    ITGB8
Reference
Pubmed ID    29337055
Trait/Disease    Glioma
Title    A novel circular RNA, hsa_circ_0046701, promotes carcinogenesis by increasing the expression of miR-142-3p target ITGB8 in glioma.
Authors    Li G, Yang H, Han K, Zhu D, Lun P, Zhao Y.
Journal    Biochem Biophys Res Commun. 2018