RefCirc
a reference database for circRNAs validated by experiments

hsa_circ_0012673 Details
Basic Information
circRNA    hsa_circ_0012673
Alias    -
circBase ID    hsa_circ_0012673
Host gene    DHCR24
Species    homo sapiens
Peptide    -
Sequence  ATTGTCCGTGTGGAGCCCTTGGTGACCATGGGCCAGGTGACTGCCCTGCTGACCTCCATTGGCTGGACTCTCCCCGTGTTGCCTGAGCTTGATGACCTCACAGTGGGGGGCTTGATCATGGGCACAGGCATCGAGTCATCATCCCACAAGTACGGCCTGTTCCAACACATCTGCACTGCTTACGAGCTGGTCCTGGCTGATGGCAGCTTTGTGCGATGCACTCCG
Expression
Description  The expression of hsa_circ_0012673 was up-regulated in LAC tissues compared to pair-matched adjacent non-tumor tissues (P = 0.0079).
Method    qRT-PCR
Sample    LAC samples from stage I-III patients, H1792, A549, PC9, H1703, H1793, H1299, HBE
Function
Description  Hsa_circ_0012673 knockdown could suppress the proliferation of LAC cells. Hsa_circ_0012673 knockdown could suppress tumour growth in vivo. Hsa_circ_0012673 expression was significant associated with tumour size (P= 0.0058).
Method    loss of function
in vitro    A549, PC9
in vivo    BALB/c nu/nu male mice (4 weeks old)
Interaction
Target    miR-22
Type    circRNA-miRNA
Sample    A549, HEK293T
Experiment    RNA FISH, luciferase
Description    Colocalization of miR-22 and hsa_circ_0012673 was observed using RNA in situ hybridization in A549 cells. Only miR-22 reduced the luciferase reporter activity by at least 50% compared with the hsa_circ_0012673_mutant (P < 0.01).
ceRNA target    ErbB3
Reference
Pubmed ID    29366790
Trait/Disease    Lung Adenocarcinoma
Title    Increased circular RNA hsa_circ_0012673 acts as a sponge of miR-22 to promote lung adenocarcinoma proliferation.
Authors    Wang X, Zhu X, Zhang H, Wei S, Chen Y, Chen Y, Wang F, Fan X, Han S, Wu G.
Journal    Biochem Biophys Res Commun. 2018