RefCirc
a reference database for circRNAs validated by experiments

hsa_circ_0007385 Details
Basic Information
circRNA    hsa_circ_0007385
Alias    -
circBase ID    hsa_circ_0007385
Host gene    MEMO1
Species    homo sapiens
Peptide    -
Sequence  CCATGCAGGATATACGTACTGTGGGTCTTGTGCTGCCCATGCTTATAAACAAGTGGATCCGTCTATTACCCGGAGAATTTTCATCCTTGGGCCTTCTCATCATGTGCCCCTCTCTCGATGTGCACTTTCCAGTGTGGATATATATAGGACACCTCTGTATGACCTTCGTATTGACCAAAAGATTTACGGAGAACTGTGGAAGACAGGAATGTTTGAACGCATGTCTCTGCAGACAGATGAAGATGAACACAGTATTGAAATGCATTTGCCTTATACAGCTAAAGCCATGGAAAG
Expression
Description  hsa_circ_0007385 was significantly up regulated in NSCLC tissue and cells
Method    microarray, qRT-PCR
Sample    NSCLC tissue and adjacent non-cancerous lung tissue, A549, SK-MES-1, H1299, and Calu-3
Function
Description  Hsa_circ_0007385 knockdown suppressed the proliferation of NSCLC cells in vitro. Hsa_circ_0007385 knockdown suppressed the migration, invasion of NSCLC cells in vitro. Hsa_circ_0007385 knockdown inhibited the tumor growth of NSCLC in vivo.
Method    loss of function
in vitro    H1299, A549
in vivo    Athymic BALB/C mice (4-6-weeks-old)
Interaction
Target    miR-181
Type    circRNA-miRNA
Sample    HEK293T
Experiment    luciferase reporter assay
Description    Luciferase reporter assay revealed the binding within miR-181 and hsa_circ_0007385.
ceRNA target    -
Reference
Pubmed ID    29372377
Trait/Disease    Non-Small Cell Lung Cancer
Title    Microarray profiles reveal that circular RNA hsa_circ_0007385 functions as an oncogene in non-small cell lung cancer tumorigenesis.
Authors    Jiang MM, Mai ZT, Wan SZ, Chi YM, Zhang X, Sun BH, Di QG.
Journal    J Cancer Res Clin Oncol. 2018