RefCirc
a reference database for circRNAs validated by experiments

cSMARCA5 Details
Basic Information
circRNA    cSMARCA5
Alias    hsa_circ_000003
circBase ID    hsa_circ_0001445
Host gene    SMARCA5
Species    homo sapiens
Peptide    -
Sequence  GGAGGCTTGTGGATCAGAATCTGAACAAAATTGGGAAAGATGAAATGCTTCAAATGATTAGACATGGAGCAACACATGTGTTTGCTTCAAAGGAAAGTGAGATCACTGATGAAGATATCGATGGTATTTTGGAAAGAGGTGCAAAGAAGACTGCAGAGATGAATGAAAAGCTCTCCAAGATGGGCGAAAGTTCACTTAGAAACTTTACAATGGATACAGAGTCAAGTGTTTATAACTTCGAAGGAGAAGACTATAGAGAAAAACAAAAG
Expression
Description  Circular RNA cSMARCA5 was downregulated in HCC. The expression of endogenous cSMARCA5 was the lowest in HCCLM3; moderate in Hep3B, MHCC97H and SMMC-7721; and the highest in Huh7.
Method    RNA-seq, northern blots, qRT-PCR
Sample    pairs of HCC and corresponding adjacent noncancerous liver tissues. HCCLM3, Hep3B, MHCC97H, SMMC-7721, Huh7
Function
Description  cSMARCA5 inhibited HCC growth and metastasis both in vitro and in vivo. Down-regulated cSMARCA5 expression predicts aggressive clinicopathological characteristics and poor prognosis in HCC patients after hepatectomy.
Method    gain of function, loss of function
in vitro    SMMC-7721, Huh7 and HCCLM3
in vivo    5 weeks old male BALB/c nude mice
Interaction
Target    miR-17-3p, miR-181b-5p
Type    circRNA-miRNA
Sample    SMMC-7721, Huh7, HEK293T
Experiment    AGO2 RIP, circRIP, luciferase reporter assay, RNA pull-down, RNA FISH
Description    All these experiments proved that cSMARCA5 may function as a sponge for miR-17-3p and miR-181b-5p.
ceRNA target    TIMP3
Reference
Pubmed ID    29378234
Trait/Disease    Hepatocellular Carcinoma
Title    Circular RNA cSMARCA5 inhibits growth and metastasis in hepatocellular carcinoma.
Authors    Yu J, Xu QG, Wang ZG, Yang Y, Zhang L, Ma JZ, Sun SH, Yang F, Zhou WP.
Journal    J Hepatol. 2018