RefCirc
a reference database for circRNAs validated by experiments
| circSGMS1_2-3-3d Details |
| Basic Information |
| circRNA | circSGMS1_2-3-3d |
| Alias | KX061765 |
| circBase ID | - |
| Host gene | SGMS1 |
| Species | homo sapiens |
| Peptide | - |
| Sequence | GGAGAAAGAAGACAGCCATCATTTGAAAGGTAAAGCTTCAGCGACTGAAGGAGTGTGGACTTTTTGAATTTCAAGAACAGTAAAGTTGGAACACAGCAGAGGGTGTGTAATAAAATACAGGTCAGAGCCTGGTCCAAAAGGTATAGAGAATTGGCAGTTACCCACAAGTCTGCCCCAAAGAGGTTCTTTCCAACCACCTGCCACACGTGACGACAGCATGTACGATCCCTGAATGGGCCCGTGGGCATATTTAGTCATTCATTTTTGATCA |
| Expression |
| Description | An analysis of the presence of circSGMS1_2-3-3d in various human tissues was performed by RT-PCR using primers F3d/R3 and F5c/R5. circSGMS1_2-3-3d was detected in cortex renis, spleen, placenta, med. Oblongata, Sub. nigra, frontal cortex, cerebellum, corpus callosum, hippocampus, lobus parietalis and thalamus, not detected in white blood cells. |
| Method | RT-PCR |
| Sample | cortex renis, spleen, placenta, med. Oblongata, Sub. nigra, frontal cortex, blood, cerebellum, corpus callosum, hippocampus, lobus parietalis and thalamus. |
| Reference |
| Pubmed ID | 29454087 |
| Trait/Disease | Sphingomyelin Synthase Activity |
| Title | Multi-step splicing of sphingomyelin synthase linear and circular RNAs. |
| Authors | Filippenkov IB, Sudarkina OY, Limborska SA, Dergunova LV. |
| Journal | Gene. 2018 |